Incidental Mutation 'R2920:Comtd1'
ID 255490
Institutional Source Beutler Lab
Gene Symbol Comtd1
Ensembl Gene ENSMUSG00000021773
Gene Name catechol-O-methyltransferase domain containing 1
Synonyms MT773, 1810030M08Rik
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R2920 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 21845855-21848977 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21847618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 149 (L149P)
Ref Sequence ENSEMBL: ENSMUSP00000134830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022293] [ENSMUST00000124549] [ENSMUST00000172727] [ENSMUST00000173456] [ENSMUST00000177527]
AlphaFold Q8BIG7
Predicted Effect probably benign
Transcript: ENSMUST00000022293
SMART Domains Protein: ENSMUSP00000022293
Gene: ENSMUSG00000021771

DomainStartEndE-ValueType
Pfam:Porin_3 15 288 4.5e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000022295
Predicted Effect possibly damaging
Transcript: ENSMUST00000124549
AA Change: L211P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119330
Gene: ENSMUSG00000021773
AA Change: L211P

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Methyltransf_3 59 262 2.7e-58 PFAM
Pfam:Methyltransf_18 102 213 5.5e-9 PFAM
Pfam:Methyltransf_24 107 210 3.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170150
Predicted Effect probably benign
Transcript: ENSMUST00000172727
SMART Domains Protein: ENSMUSP00000133525
Gene: ENSMUSG00000021771

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 6.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173456
SMART Domains Protein: ENSMUSP00000134023
Gene: ENSMUSG00000021771

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 6.4e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177527
AA Change: L149P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134830
Gene: ENSMUSG00000021773
AA Change: L149P

DomainStartEndE-ValueType
Pfam:Methyltransf_3 1 200 1.6e-64 PFAM
Pfam:Methyltransf_18 40 150 4.2e-10 PFAM
Pfam:Methyltransf_24 45 148 1.1e-15 PFAM
Meta Mutation Damage Score 0.4846 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Comtd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03063:Comtd1 APN 14 21847667 splice site probably null
IGL03068:Comtd1 APN 14 21847643 missense probably damaging 1.00
R1694:Comtd1 UTSW 14 21847330 missense probably damaging 1.00
R1887:Comtd1 UTSW 14 21847741 missense probably damaging 1.00
R1925:Comtd1 UTSW 14 21847663 missense probably damaging 1.00
R2153:Comtd1 UTSW 14 21848272 missense possibly damaging 0.81
R4923:Comtd1 UTSW 14 21848745 unclassified probably benign
R5053:Comtd1 UTSW 14 21847696 missense probably damaging 1.00
R5265:Comtd1 UTSW 14 21848793 missense probably benign 0.06
R5478:Comtd1 UTSW 14 21848913 unclassified probably benign
R5849:Comtd1 UTSW 14 21848120 missense probably damaging 1.00
R6147:Comtd1 UTSW 14 21848815 missense probably damaging 1.00
R8041:Comtd1 UTSW 14 21847917 missense probably benign 0.15
R9390:Comtd1 UTSW 14 21848799 missense possibly damaging 0.94
RF016:Comtd1 UTSW 14 21848596 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCAACAGTCTTGTTCCTGGGC -3'
(R):5'- GAACAAAACTGGCGACCCTGAG -3'

Sequencing Primer
(F):5'- TGAGGCTGCAGCACTTCTC -3'
(R):5'- AGCCCGCTGAGACCCTAG -3'
Posted On 2014-12-29