Mutagenetix > Incidental Mutation

Incidental Mutation 'R2920:Myo10'

255493

Institutional Source

Beutler Lab

Gene Symbol

Myo10

Ensembl Gene

ENSMUSG00000022272

Gene Name

myosin X

Synonyms

D15Ertd600e, myosin-X

MMRRC Submission

040505-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2920 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25622525-25813673 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 25801140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1472 (V1472L)

Ref Sequence

ENSEMBL: ENSMUSP00000106087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022882] [ENSMUST00000110457]

AlphaFold

F8VQB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000022882
AA Change: V726L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022882
Gene: ENSMUSG00000022272
AA Change: V726L

Domain	Start	End	E-Value	Type
IQ	1	17	7.83e1	SMART
IQ	18	40	1.06e0	SMART
IQ	41	63	7.07e-2	SMART
PDB:2LW9\|B	136	171	7e-13	PDB
low complexity region	172	186	N/A	INTRINSIC
low complexity region	213	235	N/A	INTRINSIC
low complexity region	344	356	N/A	INTRINSIC
low complexity region	401	419	N/A	INTRINSIC
PH	471	570	1.39e-21	SMART
SCOP:d1faoa_	588	639	3e-6	SMART
PH	651	757	6.76e-11	SMART
MyTH4	805	953	4.12e-37	SMART
B41	954	1216	1.72e-44	SMART
Blast:B41	1218	1303	3e-45	BLAST
low complexity region	1304	1316	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110457
AA Change: V1472L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: V1472L

Domain	Start	End	E-Value	Type
MYSc	57	740	N/A	SMART
IQ	741	763	1.27e-3	SMART
IQ	764	786	1.06e0	SMART
IQ	787	809	7.07e-2	SMART
Pfam:MYO10_CC	881	932	4.2e-22	PFAM
low complexity region	959	981	N/A	INTRINSIC
low complexity region	1090	1102	N/A	INTRINSIC
low complexity region	1147	1165	N/A	INTRINSIC
PH	1217	1316	1.39e-21	SMART
PH	1397	1503	6.76e-11	SMART
MyTH4	1551	1699	4.12e-37	SMART
B41	1700	1962	1.72e-44	SMART
low complexity region	2050	2062	N/A	INTRINSIC

Meta Mutation Damage Score

0.2681

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,390,243	Y1025H	probably damaging	Het
Adgrv1	C	T	13: 81,448,865	A4122T	probably benign	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Atp2b3	A	C	X: 73,533,920	T318P	probably benign	Het
Atrx	A	T	X: 105,830,868	V1962D	probably benign	Het
Chl1	C	A	6: 103,695,343	T531K	probably damaging	Het
Clca3b	T	A	3: 144,837,853	D405V	probably benign	Het
Clca3b	C	T	3: 144,846,931	D115N	probably benign	Het
Comtd1	A	G	14: 21,847,618	L149P	possibly damaging	Het
Cops7a	A	G	6: 124,962,362	V108A	probably benign	Het
Crebbp	A	G	16: 4,119,082	V343A	probably damaging	Het
Edrf1	T	A	7: 133,667,572	D1109E	probably benign	Het
Elmo3	A	G	8: 105,308,059	E359G	possibly damaging	Het
Ep400	C	A	5: 110,755,914	G273V	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Glb1l	T	A	1: 75,209,190	E31D	probably benign	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Il12rb2	C	T	6: 67,360,568	V110I	probably damaging	Het
Ints3	T	C	3: 90,393,162	E884G	probably benign	Het
Lin7b	A	G	7: 45,368,397	V170A	possibly damaging	Het
Lrch2	A	T	X: 147,473,030	V750E	probably damaging	Het
Mepe	C	T	5: 104,338,247	R418C	probably damaging	Het
Mettl25	A	T	10: 105,765,177		probably null	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo9b	A	G	8: 71,325,857	K445R	probably damaging	Het
Ntng2	T	C	2: 29,204,211	M383V	probably benign	Het
Olfr1353	A	C	10: 78,970,012	D121A	probably damaging	Het
Olfr30	T	C	11: 58,455,577	Y124C	probably damaging	Het
Olfr702	C	T	7: 106,824,364	R54Q	probably benign	Het
Pak6	A	T	2: 118,694,007		probably benign	Het
Pcdh8	G	T	14: 79,768,714	P803Q	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rint1	A	G	5: 23,805,402	E203G	probably benign	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc14a2	G	T	18: 78,158,297	S669*	probably null	Het
Slc38a7	A	G	8: 95,845,943	I157T	possibly damaging	Het
Slc4a5	T	C	6: 83,264,387	L215P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,469	V60A	probably benign	Het
Tcerg1l	T	C	7: 138,248,379	R422G	probably damaging	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Vmn1r19	A	T	6: 57,404,924	N154I	probably benign	Het
Vmn2r69	T	A	7: 85,411,765	I204L	probably benign	Het
Zbtb1	T	A	12: 76,385,845	S202T	possibly damaging	Het

Other mutations in Myo10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Myo10	APN	15	25776380	missense	probably damaging	1.00
IGL01068:Myo10	APN	15	25739309	missense	possibly damaging	0.93
IGL01352:Myo10	APN	15	25701697	missense	probably damaging	1.00
IGL01388:Myo10	APN	15	25736617	missense	possibly damaging	0.55
IGL01460:Myo10	APN	15	25714108	missense	probably benign	0.00
IGL01553:Myo10	APN	15	25776329	missense	probably damaging	1.00
IGL01732:Myo10	APN	15	25732063	missense	probably benign	0.10
IGL01992:Myo10	APN	15	25799548	missense	possibly damaging	0.92
IGL02000:Myo10	APN	15	25808066	missense	probably damaging	1.00
IGL02045:Myo10	APN	15	25726488	missense	probably benign	0.03
IGL02307:Myo10	APN	15	25776315	splice site	probably benign
IGL02511:Myo10	APN	15	25723889	missense	probably damaging	0.97
IGL03240:Myo10	APN	15	25701602	missense	probably damaging	1.00
least	UTSW	15	25726475	nonsense	probably null
R0037:Myo10	UTSW	15	25666532	intron	probably benign
R0153:Myo10	UTSW	15	25781238	missense	possibly damaging	0.84
R0282:Myo10	UTSW	15	25793167	missense	probably damaging	1.00
R0360:Myo10	UTSW	15	25804368	missense	probably damaging	1.00
R0585:Myo10	UTSW	15	25736455	missense	probably damaging	1.00
R0617:Myo10	UTSW	15	25738005	missense	probably damaging	1.00
R0729:Myo10	UTSW	15	25722157	splice site	probably benign
R0771:Myo10	UTSW	15	25778178	missense	probably damaging	1.00
R0960:Myo10	UTSW	15	25801189	missense	probably damaging	1.00
R1562:Myo10	UTSW	15	25780411	missense	possibly damaging	0.81
R1651:Myo10	UTSW	15	25742369	missense	probably damaging	1.00
R1789:Myo10	UTSW	15	25726525	critical splice donor site	probably null
R1816:Myo10	UTSW	15	25800200	missense	probably damaging	1.00
R1835:Myo10	UTSW	15	25805587	missense	possibly damaging	0.53
R1908:Myo10	UTSW	15	25801222	missense	probably damaging	1.00
R2082:Myo10	UTSW	15	25785993	missense	probably damaging	1.00
R2101:Myo10	UTSW	15	25722259	missense	probably benign	0.26
R2129:Myo10	UTSW	15	25781799	missense	probably benign	0.09
R2141:Myo10	UTSW	15	25714108	missense	probably benign
R2142:Myo10	UTSW	15	25714108	missense	probably benign
R2938:Myo10	UTSW	15	25795717	missense	probably damaging	0.99
R3723:Myo10	UTSW	15	25803288	missense	probably damaging	1.00
R3852:Myo10	UTSW	15	25779626	missense	probably damaging	1.00
R4162:Myo10	UTSW	15	25726415	splice site	probably null
R4163:Myo10	UTSW	15	25726415	splice site	probably null
R4164:Myo10	UTSW	15	25726415	splice site	probably null
R4177:Myo10	UTSW	15	25734051	missense	possibly damaging	0.81
R4409:Myo10	UTSW	15	25807869	missense	probably damaging	1.00
R4667:Myo10	UTSW	15	25793153	missense	possibly damaging	0.91
R4905:Myo10	UTSW	15	25800212	missense	probably damaging	0.99
R4933:Myo10	UTSW	15	25781118	missense	probably damaging	0.96
R4968:Myo10	UTSW	15	25808184	missense	probably damaging	1.00
R5081:Myo10	UTSW	15	25785940	missense	probably damaging	1.00
R5123:Myo10	UTSW	15	25726483	missense	possibly damaging	0.94
R5310:Myo10	UTSW	15	25778078	splice site	probably null
R6073:Myo10	UTSW	15	25736642	missense	probably damaging	1.00
R6117:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6185:Myo10	UTSW	15	25726510	missense	probably damaging	0.99
R6749:Myo10	UTSW	15	25714110	missense	probably damaging	1.00
R6819:Myo10	UTSW	15	25781410	missense	possibly damaging	0.80
R6875:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6908:Myo10	UTSW	15	25804383	missense	probably damaging	1.00
R6963:Myo10	UTSW	15	25734063	missense	probably benign	0.31
R7144:Myo10	UTSW	15	25723925	missense	probably damaging	1.00
R7266:Myo10	UTSW	15	25782981	missense	probably damaging	1.00
R7380:Myo10	UTSW	15	25779620	missense	probably benign	0.01
R7460:Myo10	UTSW	15	25807827	missense	probably damaging	1.00
R7614:Myo10	UTSW	15	25701623	missense	probably benign	0.00
R7618:Myo10	UTSW	15	25726475	nonsense	probably null
R7717:Myo10	UTSW	15	25731970	missense	probably benign	0.01
R7811:Myo10	UTSW	15	25804524	missense	probably damaging	1.00
R7830:Myo10	UTSW	15	25737971	nonsense	probably null
R7862:Myo10	UTSW	15	25666436	missense	probably damaging	1.00
R8232:Myo10	UTSW	15	25804314	missense	possibly damaging	0.89
R8264:Myo10	UTSW	15	25800109	missense	probably damaging	0.99
R8377:Myo10	UTSW	15	25804395	missense	possibly damaging	0.94
R8385:Myo10	UTSW	15	25804398	missense	probably damaging	1.00
R8426:Myo10	UTSW	15	25799490	missense	probably damaging	0.99
R8439:Myo10	UTSW	15	25725072	missense	probably benign	0.00
R8696:Myo10	UTSW	15	25799486	missense	probably damaging	1.00
R8775:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8775-TAIL:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8970:Myo10	UTSW	15	25803381	missense	possibly damaging	0.82
R9024:Myo10	UTSW	15	25793209	missense	possibly damaging	0.53
R9196:Myo10	UTSW	15	25805630	missense	probably damaging	0.96
R9224:Myo10	UTSW	15	25807995	missense	probably benign	0.33
R9308:Myo10	UTSW	15	25781776	missense	probably damaging	0.99
R9358:Myo10	UTSW	15	25781434	missense	possibly damaging	0.69
R9606:Myo10	UTSW	15	25776315	frame shift	probably null
R9722:Myo10	UTSW	15	25801141	missense	probably damaging	1.00
RF013:Myo10	UTSW	15	25799479	missense	probably damaging	0.99
Z1177:Myo10	UTSW	15	25781401	missense	probably damaging	1.00
Z1177:Myo10	UTSW	15	25799554	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGTGTTCCTTAGAGAGATGGACC -3'
(R):5'- GGCATCTGTAACAGCAAGGG -3'

Sequencing Primer
(F):5'- CCTTAGAGAGATGGACCTCCTTG -3'
(R):5'- GAAGGGACCACAAGGAACTCC -3'

Posted On

2014-12-29