Mutagenetix > Incidental Mutation

Incidental Mutation 'R2920:Crebbp'

255494

Institutional Source

Beutler Lab

Gene Symbol

Crebbp

Ensembl Gene

ENSMUSG00000022521

Gene Name

CREB binding protein

Synonyms

KAT3A, CBP

MMRRC Submission

040505-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2920 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4081328-4213997 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4119082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 343 (V343A)

Ref Sequence

ENSEMBL: ENSMUSP00000146029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205344] [ENSMUST00000205765]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023165
AA Change: V807A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: V807A

Domain	Start	End	E-Value	Type
low complexity region	47	58	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	95	105	N/A	INTRINSIC
low complexity region	213	233	N/A	INTRINSIC
low complexity region	261	272	N/A	INTRINSIC
ZnF_TAZ	347	432	2.31e-32	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:KIX	586	666	1.4e-42	PFAM
low complexity region	874	893	N/A	INTRINSIC
low complexity region	909	958	N/A	INTRINSIC
low complexity region	1045	1065	N/A	INTRINSIC
BROMO	1085	1195	4.26e-43	SMART
Blast:KAT11	1265	1308	3e-15	BLAST
KAT11	1343	1649	4.25e-137	SMART
ZnF_ZZ	1702	1743	2.17e-15	SMART
ZnF_TAZ	1767	1845	6.8e-30	SMART
low complexity region	1847	1877	N/A	INTRINSIC
low complexity region	1884	1914	N/A	INTRINSIC
low complexity region	1942	1971	N/A	INTRINSIC
Pfam:Creb_binding	2019	2115	8.2e-38	PFAM
low complexity region	2147	2161	N/A	INTRINSIC
low complexity region	2197	2216	N/A	INTRINSIC
low complexity region	2260	2279	N/A	INTRINSIC
low complexity region	2286	2304	N/A	INTRINSIC
low complexity region	2343	2378	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000205344
AA Change: V343A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

unknown
Transcript: ENSMUST00000205685
AA Change: V230A

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205765
AA Change: V769A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,390,243	Y1025H	probably damaging	Het
Adgrv1	C	T	13: 81,448,865	A4122T	probably benign	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Atp2b3	A	C	X: 73,533,920	T318P	probably benign	Het
Atrx	A	T	X: 105,830,868	V1962D	probably benign	Het
Chl1	C	A	6: 103,695,343	T531K	probably damaging	Het
Clca3b	T	A	3: 144,837,853	D405V	probably benign	Het
Clca3b	C	T	3: 144,846,931	D115N	probably benign	Het
Comtd1	A	G	14: 21,847,618	L149P	possibly damaging	Het
Cops7a	A	G	6: 124,962,362	V108A	probably benign	Het
Edrf1	T	A	7: 133,667,572	D1109E	probably benign	Het
Elmo3	A	G	8: 105,308,059	E359G	possibly damaging	Het
Ep400	C	A	5: 110,755,914	G273V	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Glb1l	T	A	1: 75,209,190	E31D	probably benign	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Il12rb2	C	T	6: 67,360,568	V110I	probably damaging	Het
Ints3	T	C	3: 90,393,162	E884G	probably benign	Het
Lin7b	A	G	7: 45,368,397	V170A	possibly damaging	Het
Lrch2	A	T	X: 147,473,030	V750E	probably damaging	Het
Mepe	C	T	5: 104,338,247	R418C	probably damaging	Het
Mettl25	A	T	10: 105,765,177		probably null	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo10	G	T	15: 25,801,140	V1472L	probably damaging	Het
Myo9b	A	G	8: 71,325,857	K445R	probably damaging	Het
Ntng2	T	C	2: 29,204,211	M383V	probably benign	Het
Olfr1353	A	C	10: 78,970,012	D121A	probably damaging	Het
Olfr30	T	C	11: 58,455,577	Y124C	probably damaging	Het
Olfr702	C	T	7: 106,824,364	R54Q	probably benign	Het
Pak6	A	T	2: 118,694,007		probably benign	Het
Pcdh8	G	T	14: 79,768,714	P803Q	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rint1	A	G	5: 23,805,402	E203G	probably benign	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc14a2	G	T	18: 78,158,297	S669*	probably null	Het
Slc38a7	A	G	8: 95,845,943	I157T	possibly damaging	Het
Slc4a5	T	C	6: 83,264,387	L215P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,469	V60A	probably benign	Het
Tcerg1l	T	C	7: 138,248,379	R422G	probably damaging	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Vmn1r19	A	T	6: 57,404,924	N154I	probably benign	Het
Vmn2r69	T	A	7: 85,411,765	I204L	probably benign	Het
Zbtb1	T	A	12: 76,385,845	S202T	possibly damaging	Het

Other mutations in Crebbp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Crebbp	APN	16	4179552	missense	probably benign
IGL01366:Crebbp	APN	16	4126506	missense	probably damaging	1.00
IGL01457:Crebbp	APN	16	4124768	missense	probably damaging	0.99
IGL01713:Crebbp	APN	16	4128648	missense	possibly damaging	0.79
IGL02382:Crebbp	APN	16	4108070	missense	probably damaging	1.00
IGL02513:Crebbp	APN	16	4126605	splice site	probably null
IGL02519:Crebbp	APN	16	4101593	missense	possibly damaging	0.80
IGL02533:Crebbp	APN	16	4107432	missense	probably damaging	1.00
IGL02582:Crebbp	APN	16	4084277	missense	possibly damaging	0.87
IGL02600:Crebbp	APN	16	4155018	missense	probably benign
IGL02716:Crebbp	APN	16	4114878	missense	probably benign	0.22
IGL02736:Crebbp	APN	16	4154910	missense	probably benign	0.00
IGL03349:Crebbp	APN	16	4117358	missense	possibly damaging	0.69
enchanting	UTSW	16	4119806	missense	possibly damaging	0.92
Intriguing	UTSW	16	4180022	missense	possibly damaging	0.83
Rivetting	UTSW	16	4091889	missense	probably damaging	1.00
Stunning	UTSW	16	4091928	missense	probably damaging	1.00
Suggestive	UTSW	16	4108127	missense	probably damaging	1.00
PIT4418001:Crebbp	UTSW	16	4114825	missense	probably benign	0.02
R0022:Crebbp	UTSW	16	4085228	missense	probably damaging	1.00
R0029:Crebbp	UTSW	16	4117443	missense	probably damaging	1.00
R0098:Crebbp	UTSW	16	4091928	missense	probably damaging	1.00
R0098:Crebbp	UTSW	16	4091928	missense	probably damaging	1.00
R0125:Crebbp	UTSW	16	4117241	splice site	probably benign
R0126:Crebbp	UTSW	16	4084063	missense	possibly damaging	0.94
R0140:Crebbp	UTSW	16	4117499	missense	probably damaging	1.00
R0546:Crebbp	UTSW	16	4085807	missense	probably damaging	0.99
R0705:Crebbp	UTSW	16	4155010	missense	possibly damaging	0.95
R0801:Crebbp	UTSW	16	4088276	missense	probably damaging	1.00
R1103:Crebbp	UTSW	16	4084061	missense	probably damaging	0.97
R1225:Crebbp	UTSW	16	4126956	missense	probably benign	0.04
R1421:Crebbp	UTSW	16	4124647	missense	probably damaging	1.00
R1513:Crebbp	UTSW	16	4115885	missense	probably damaging	1.00
R1531:Crebbp	UTSW	16	4084517	missense	probably benign	0.04
R1860:Crebbp	UTSW	16	4087736	missense	possibly damaging	0.68
R1941:Crebbp	UTSW	16	4179691	missense	probably benign
R1953:Crebbp	UTSW	16	4179449	missense	probably benign	0.23
R1992:Crebbp	UTSW	16	4128697	splice site	probably null
R2000:Crebbp	UTSW	16	4084252	missense	probably damaging	0.98
R2006:Crebbp	UTSW	16	4084753	unclassified	probably benign
R2022:Crebbp	UTSW	16	4085819	missense	probably damaging	1.00
R2044:Crebbp	UTSW	16	4084823	missense	probably benign	0.04
R2185:Crebbp	UTSW	16	4084138	missense	probably damaging	0.99
R2203:Crebbp	UTSW	16	4138777	missense	possibly damaging	0.72
R2349:Crebbp	UTSW	16	4138910	missense	probably damaging	1.00
R2430:Crebbp	UTSW	16	4096465	missense	probably damaging	1.00
R2438:Crebbp	UTSW	16	4154858	missense	possibly damaging	0.90
R2842:Crebbp	UTSW	16	4109198	missense	probably damaging	1.00
R2896:Crebbp	UTSW	16	4138816	missense	probably damaging	1.00
R3118:Crebbp	UTSW	16	4109198	missense	probably damaging	1.00
R3894:Crebbp	UTSW	16	4096102	missense	probably benign	0.11
R4177:Crebbp	UTSW	16	4119799	missense	possibly damaging	0.48
R4692:Crebbp	UTSW	16	4114863	missense	possibly damaging	0.64
R4790:Crebbp	UTSW	16	4180119	missense	probably damaging	0.98
R4884:Crebbp	UTSW	16	4088375	missense	probably damaging	1.00
R4957:Crebbp	UTSW	16	4117367	missense	probably benign	0.14
R5109:Crebbp	UTSW	16	4088431	intron	probably benign
R5121:Crebbp	UTSW	16	4093511	missense	probably damaging	1.00
R5420:Crebbp	UTSW	16	4107458	missense	probably damaging	1.00
R5455:Crebbp	UTSW	16	4085967	missense	probably benign	0.45
R5485:Crebbp	UTSW	16	4114913	missense	probably benign
R5660:Crebbp	UTSW	16	4154858	missense	possibly damaging	0.90
R5724:Crebbp	UTSW	16	4087635	unclassified	probably benign
R5771:Crebbp	UTSW	16	4119772	missense	probably benign	0.03
R5825:Crebbp	UTSW	16	4087742	missense	probably damaging	0.99
R5919:Crebbp	UTSW	16	4108127	missense	probably damaging	1.00
R5965:Crebbp	UTSW	16	4087661	unclassified	probably benign
R6021:Crebbp	UTSW	16	4085418	missense	probably damaging	1.00
R6146:Crebbp	UTSW	16	4084623	nonsense	probably null
R6521:Crebbp	UTSW	16	4119128	missense	probably damaging	0.99
R6571:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6617:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6618:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6634:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6646:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6647:Crebbp	UTSW	16	4119806	missense	possibly damaging	0.92
R6766:Crebbp	UTSW	16	4117500	missense	probably damaging	1.00
R6836:Crebbp	UTSW	16	4180022	missense	possibly damaging	0.83
R7022:Crebbp	UTSW	16	4117323	missense	probably damaging	0.98
R7210:Crebbp	UTSW	16	4084257	missense	possibly damaging	0.95
R7568:Crebbp	UTSW	16	4126489	missense	probably benign	0.34
R7672:Crebbp	UTSW	16	4084710	missense	probably benign	0.06
R8145:Crebbp	UTSW	16	4128525	missense	probably benign	0.03
R8152:Crebbp	UTSW	16	4085081	missense	possibly damaging	0.95
R8374:Crebbp	UTSW	16	4084311	missense	probably damaging	0.99
R8392:Crebbp	UTSW	16	4084281	missense	possibly damaging	0.49
R8679:Crebbp	UTSW	16	4084458	missense	probably damaging	0.99
R8738:Crebbp	UTSW	16	4119088	missense	probably benign	0.07
R8756:Crebbp	UTSW	16	4085903	missense	probably benign	0.01
R8847:Crebbp	UTSW	16	4085027	missense	probably benign	0.01
R8950:Crebbp	UTSW	16	4213159	missense	probably damaging	0.98
R8958:Crebbp	UTSW	16	4213308	start gained	probably benign
R8964:Crebbp	UTSW	16	4091889	missense	probably damaging	1.00
R8972:Crebbp	UTSW	16	4108071	missense	probably benign	0.17
R9069:Crebbp	UTSW	16	4085323	missense	probably benign
R9155:Crebbp	UTSW	16	4096482	missense	probably damaging	1.00
R9240:Crebbp	UTSW	16	4099673	critical splice donor site	probably null
R9414:Crebbp	UTSW	16	4107492	missense	probably damaging	1.00
R9500:Crebbp	UTSW	16	4093491	missense	probably damaging	0.98
R9549:Crebbp	UTSW	16	4085247	missense	probably benign	0.03
R9663:Crebbp	UTSW	16	4115790	missense	probably damaging	0.99
X0012:Crebbp	UTSW	16	4087765	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGTGAAGTTTACCTAGAGGGAAC -3'
(R):5'- TGTGATCTCTTGAAGACTCTGACC -3'

Sequencing Primer
(F):5'- AATTATAGGGCAAACGGGAAATG -3'
(R):5'- TGAAGACTCTGACCTAACACTTCTG -3'

Posted On

2014-12-29