Incidental Mutation 'R2920:Gm10093'
ID255496
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Namepredicted pseudogene 10093
SynonymsEG15181
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R2920 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location78491565-78493541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78492846 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 422 (D422G)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
Predicted Effect probably damaging
Transcript: ENSMUST00000079363
AA Change: D422G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: D422G

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2416:Gm10093 UTSW 17 78492516 missense probably damaging 1.00
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R4546:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R5297:Gm10093 UTSW 17 78492758 missense probably benign
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6568:Gm10093 UTSW 17 78492588 missense probably damaging 1.00
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAAGCTTCACATCAGCCC -3'
(R):5'- CTTGCTCAGGCCAACTTGAC -3'

Sequencing Primer
(F):5'- GATCAAGCAGCGTCTCTTTGAGAAC -3'
(R):5'- CAGGCCAACTTGACCTCTTC -3'
Posted On2014-12-29