Mutagenetix > Incidental Mutation

Incidental Mutation 'R2920:Slc14a2'

255497

Institutional Source

Beutler Lab

Gene Symbol

Slc14a2

Ensembl Gene

ENSMUSG00000024552

Gene Name

solute carrier family 14 (urea transporter), member 2

Synonyms

UT-A5, UT-A3

MMRRC Submission

040505-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2920 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78146940-78209094 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 78158297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 669 (S669*)

Ref Sequence

ENSEMBL: ENSMUSP00000025434 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025434]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000025434
AA Change: S669*

SMART Domains

Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: S669*

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:UT	128	423	1.9e-105	PFAM
low complexity region	460	471	N/A	INTRINSIC
Pfam:UT	591	886	7.5e-112	PFAM

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

96% (48/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	G	10: 10,390,243	Y1025H	probably damaging	Het
Adgrv1	C	T	13: 81,448,865	A4122T	probably benign	Het
Aloxe3	C	T	11: 69,142,923	T621I	probably damaging	Het
Atp2b3	A	C	X: 73,533,920	T318P	probably benign	Het
Atrx	A	T	X: 105,830,868	V1962D	probably benign	Het
Chl1	C	A	6: 103,695,343	T531K	probably damaging	Het
Clca3b	T	A	3: 144,837,853	D405V	probably benign	Het
Clca3b	C	T	3: 144,846,931	D115N	probably benign	Het
Comtd1	A	G	14: 21,847,618	L149P	possibly damaging	Het
Cops7a	A	G	6: 124,962,362	V108A	probably benign	Het
Crebbp	A	G	16: 4,119,082	V343A	probably damaging	Het
Edrf1	T	A	7: 133,667,572	D1109E	probably benign	Het
Elmo3	A	G	8: 105,308,059	E359G	possibly damaging	Het
Ep400	C	A	5: 110,755,914	G273V	probably damaging	Het
Fgfr3	A	G	5: 33,733,940	N516S	probably damaging	Het
Glb1l	T	A	1: 75,209,190	E31D	probably benign	Het
Gm10093	A	G	17: 78,492,846	D422G	probably damaging	Het
Il12rb2	C	T	6: 67,360,568	V110I	probably damaging	Het
Ints3	T	C	3: 90,393,162	E884G	probably benign	Het
Lin7b	A	G	7: 45,368,397	V170A	possibly damaging	Het
Lrch2	A	T	X: 147,473,030	V750E	probably damaging	Het
Mepe	C	T	5: 104,338,247	R418C	probably damaging	Het
Mettl25	A	T	10: 105,765,177		probably null	Het
Mphosph9	G	A	5: 124,261,006	T982I	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo10	G	T	15: 25,801,140	V1472L	probably damaging	Het
Myo9b	A	G	8: 71,325,857	K445R	probably damaging	Het
Ntng2	T	C	2: 29,204,211	M383V	probably benign	Het
Olfr1353	A	C	10: 78,970,012	D121A	probably damaging	Het
Olfr30	T	C	11: 58,455,577	Y124C	probably damaging	Het
Olfr702	C	T	7: 106,824,364	R54Q	probably benign	Het
Pak6	A	T	2: 118,694,007		probably benign	Het
Pcdh8	G	T	14: 79,768,714	P803Q	possibly damaging	Het
Pfkfb3	C	T	2: 11,484,327	V286I	probably benign	Het
Rbp3	C	T	14: 33,956,018	T641M	probably damaging	Het
Rint1	A	G	5: 23,805,402	E203G	probably benign	Het
Sdf2	G	C	11: 78,254,854	V126L	probably damaging	Het
Slc13a5	T	C	11: 72,247,791	E442G	possibly damaging	Het
Slc38a7	A	G	8: 95,845,943	I157T	possibly damaging	Het
Slc4a5	T	C	6: 83,264,387	L215P	probably damaging	Het
Tbc1d9	T	C	8: 83,210,469	V60A	probably benign	Het
Tcerg1l	T	C	7: 138,248,379	R422G	probably damaging	Het
Tmem107	T	C	11: 69,071,421	L68P	probably damaging	Het
Ugt2b5	A	G	5: 87,125,407	F467L	possibly damaging	Het
Vmn1r19	A	T	6: 57,404,924	N154I	probably benign	Het
Vmn2r69	T	A	7: 85,411,765	I204L	probably benign	Het
Zbtb1	T	A	12: 76,385,845	S202T	possibly damaging	Het

Other mutations in Slc14a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Slc14a2	APN	18	78150438	missense	possibly damaging	0.65
IGL00763:Slc14a2	APN	18	78192238	missense	probably damaging	1.00
IGL01359:Slc14a2	APN	18	78154108	missense	probably benign	0.01
IGL01400:Slc14a2	APN	18	78192213	missense	probably damaging	1.00
IGL01450:Slc14a2	APN	18	78183530	missense	probably damaging	0.97
IGL01469:Slc14a2	APN	18	78155566	missense	probably damaging	0.98
IGL02231:Slc14a2	APN	18	78209021	missense	possibly damaging	0.92
IGL02340:Slc14a2	APN	18	78163126	missense	probably damaging	1.00
IGL02542:Slc14a2	APN	18	78209087	missense	probably benign
xi_ning	UTSW	18	78195747	missense	probably benign	0.01
IGL02991:Slc14a2	UTSW	18	78205834	start codon destroyed	probably null	0.77
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0132:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0601:Slc14a2	UTSW	18	78157179	nonsense	probably null
R1677:Slc14a2	UTSW	18	78163204	missense	probably benign
R1749:Slc14a2	UTSW	18	78147080	missense	possibly damaging	0.67
R2014:Slc14a2	UTSW	18	78150386	splice site	probably benign
R2034:Slc14a2	UTSW	18	78183583	missense	probably damaging	0.99
R2264:Slc14a2	UTSW	18	78163089	splice site	probably benign
R2278:Slc14a2	UTSW	18	78159944	missense	probably benign	0.01
R3878:Slc14a2	UTSW	18	78159074	missense	probably benign
R4086:Slc14a2	UTSW	18	78205783	missense	probably damaging	1.00
R4237:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4238:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4239:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4300:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4373:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4375:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4376:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4440:Slc14a2	UTSW	18	78195747	missense	probably benign	0.01
R4551:Slc14a2	UTSW	18	78195853	missense	probably benign	0.02
R4636:Slc14a2	UTSW	18	78195792	missense	possibly damaging	0.88
R4749:Slc14a2	UTSW	18	78155581	missense	probably damaging	1.00
R4921:Slc14a2	UTSW	18	78192188	missense	probably damaging	0.97
R4983:Slc14a2	UTSW	18	78150401	missense	probably damaging	0.98
R5114:Slc14a2	UTSW	18	78195748	missense	possibly damaging	0.62
R5164:Slc14a2	UTSW	18	78157272	missense	probably damaging	1.00
R5386:Slc14a2	UTSW	18	78185840	missense	possibly damaging	0.65
R5433:Slc14a2	UTSW	18	78208928	missense	probably damaging	1.00
R5558:Slc14a2	UTSW	18	78159166	missense	possibly damaging	0.94
R5571:Slc14a2	UTSW	18	78209067	missense	possibly damaging	0.73
R5693:Slc14a2	UTSW	18	78147014	missense	probably benign	0.23
R5715:Slc14a2	UTSW	18	78158336	missense	probably damaging	1.00
R5719:Slc14a2	UTSW	18	78209042	missense	probably benign	0.06
R6160:Slc14a2	UTSW	18	78158975	critical splice donor site	probably null
R6352:Slc14a2	UTSW	18	78209094	start codon destroyed	probably null
R6380:Slc14a2	UTSW	18	78146975	missense	probably benign	0.00
R6444:Slc14a2	UTSW	18	78154102	missense	probably damaging	0.98
R6480:Slc14a2	UTSW	18	78159082	missense	possibly damaging	0.80
R6732:Slc14a2	UTSW	18	78192174	missense	probably damaging	1.00
R7038:Slc14a2	UTSW	18	78159037	missense	probably damaging	0.98
R7553:Slc14a2	UTSW	18	78155588	missense	probably damaging	1.00
R7558:Slc14a2	UTSW	18	78192119	missense	probably benign	0.07
R7617:Slc14a2	UTSW	18	78159941	missense	probably benign
R7693:Slc14a2	UTSW	18	78154003	missense	possibly damaging	0.81
R7874:Slc14a2	UTSW	18	78160768	missense	probably benign	0.01
R8144:Slc14a2	UTSW	18	78184544	critical splice donor site	probably null
R9205:Slc14a2	UTSW	18	78195736	missense	probably benign	0.19
R9356:Slc14a2	UTSW	18	78184608	missense	probably null	0.02
Z1088:Slc14a2	UTSW	18	78195780	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157368	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157369	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- CGGTATTCCTGACATTCAAGC -3'
(R):5'- GGTACCCTGATTTGGAGATGGC -3'

Sequencing Primer
(F):5'- GGTATTCCTGACATTCAAGCCAAAC -3'
(R):5'- GCTTATAGGGCCCCAAGTTAG -3'

Posted On

2014-12-29