Incidental Mutation 'R2920:Atp2b3'
ID 255498
Institutional Source Beutler Lab
Gene Symbol Atp2b3
Ensembl Gene ENSMUSG00000031376
Gene Name ATPase, Ca++ transporting, plasma membrane 3
Synonyms Pmca3, 6430519O13Rik
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2920 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 73503086-73571005 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 73533920 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 318 (T318P)
Ref Sequence ENSEMBL: ENSMUSP00000085775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033744] [ENSMUST00000088429] [ENSMUST00000114479]
AlphaFold Q0VF55
Predicted Effect probably benign
Transcript: ENSMUST00000033744
AA Change: T318P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033744
Gene: ENSMUSG00000031376
AA Change: T318P

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 159 463 3.3e-58 PFAM
Pfam:Hydrolase 467 806 2.1e-27 PFAM
Pfam:HAD 470 803 2.4e-17 PFAM
Pfam:Hydrolase_like2 516 612 2.4e-17 PFAM
Pfam:Hydrolase_3 764 839 7.4e-7 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 2.4e-47 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1115 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088429
AA Change: T318P

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085775
Gene: ENSMUSG00000031376
AA Change: T318P

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 158 310 1.8e-29 PFAM
Pfam:E1-E2_ATPase 348 462 3e-13 PFAM
Pfam:Hydrolase 467 806 1.3e-16 PFAM
Pfam:HAD 470 803 3.8e-21 PFAM
Pfam:Cation_ATPase 516 612 7.9e-18 PFAM
Pfam:Hydrolase_3 764 839 5.4e-7 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 1.5e-48 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1152 4.1e-27 PFAM
low complexity region 1174 1184 N/A INTRINSIC
low complexity region 1193 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114479
AA Change: T318P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110123
Gene: ENSMUSG00000031376
AA Change: T318P

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.39e-4 SMART
Pfam:E1-E2_ATPase 159 463 4.1e-58 PFAM
Pfam:Hydrolase 467 806 4.9e-27 PFAM
Pfam:HAD 470 803 4.7e-17 PFAM
Pfam:Hydrolase_like2 516 612 1.8e-17 PFAM
Pfam:Hydrolase_3 764 839 2.1e-6 PFAM
transmembrane domain 852 874 N/A INTRINSIC
Pfam:Cation_ATPase_C 876 1058 2.3e-47 PFAM
low complexity region 1076 1096 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1100 1163 2.4e-15 PFAM
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 3. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Atp2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Atp2b3 APN X 73545360 splice site probably benign
IGL02640:Atp2b3 APN X 73542205 missense probably benign
R1518:Atp2b3 UTSW X 73545123 small deletion probably benign
R1571:Atp2b3 UTSW X 73545106 missense probably damaging 1.00
R4214:Atp2b3 UTSW X 73570315 missense probably benign 0.00
X0004:Atp2b3 UTSW X 73535494 missense probably damaging 0.99
Z1176:Atp2b3 UTSW X 73535424 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGTCAGAACTGCCAGCAATTG -3'
(R):5'- TGCCTTGGTAGCAGGTAGTC -3'

Sequencing Primer
(F):5'- CCAGCAATTGGGCATCTCC -3'
(R):5'- TTGGTAGCAGGTAGTCCCTCC -3'
Posted On 2014-12-29