Incidental Mutation 'R2920:Lrch2'
ID 255500
Institutional Source Beutler Lab
Gene Symbol Lrch2
Ensembl Gene ENSMUSG00000031290
Gene Name leucine-rich repeats and calponin homology (CH) domain containing 2
Synonyms
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R2920 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 147470375-147554081 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 147473030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 750 (V750E)
Ref Sequence ENSEMBL: ENSMUSP00000108438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112819] [ENSMUST00000152838]
AlphaFold Q3UMG5
Predicted Effect probably damaging
Transcript: ENSMUST00000112819
AA Change: V750E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108438
Gene: ENSMUSG00000031290
AA Change: V750E

DomainStartEndE-ValueType
low complexity region 6 52 N/A INTRINSIC
LRR 141 163 7.59e1 SMART
LRR_TYP 164 187 4.11e-2 SMART
LRR 209 231 6.59e1 SMART
LRR 232 255 2.67e-1 SMART
LRR 277 300 3.36e1 SMART
low complexity region 437 454 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
CH 656 759 1.98e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134265
Predicted Effect unknown
Transcript: ENSMUST00000136789
AA Change: V760E
SMART Domains Protein: ENSMUSP00000123633
Gene: ENSMUSG00000031290
AA Change: V760E

DomainStartEndE-ValueType
low complexity region 17 63 N/A INTRINSIC
LRR 152 174 7.59e1 SMART
LRR_TYP 175 198 4.11e-2 SMART
LRR 220 242 6.59e1 SMART
LRR 243 266 2.67e-1 SMART
LRR 288 311 3.36e1 SMART
low complexity region 448 465 N/A INTRINSIC
low complexity region 473 488 N/A INTRINSIC
low complexity region 591 604 N/A INTRINSIC
CH 667 770 1.98e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137665
AA Change: V440E
SMART Domains Protein: ENSMUSP00000117458
Gene: ENSMUSG00000031290
AA Change: V440E

DomainStartEndE-ValueType
low complexity region 150 167 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
CH 347 450 1.98e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152838
AA Change: V429E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121128
Gene: ENSMUSG00000031290
AA Change: V429E

DomainStartEndE-ValueType
low complexity region 133 150 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
CH 335 438 1.98e-14 SMART
Meta Mutation Damage Score 0.7196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat and calponin homology domain-containing protein family. These family members contain multiple N-terminal leucine-rich repeats, in addition to a C-terminal calponin homology domain, a type of domain that mediates interactions with actin filaments. These proteins are conserved across animal species, and studies of a similar Drosophila protein indicate a function as a cytoskeletal scaffolding protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Lrch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Lrch2 APN X 147553720 missense possibly damaging 0.75
IGL02619:Lrch2 APN X 147480541 missense probably damaging 1.00
IGL02619:Lrch2 APN X 147519135 missense probably damaging 1.00
R3885:Lrch2 UTSW X 147473007 missense probably damaging 1.00
R3886:Lrch2 UTSW X 147473007 missense probably damaging 1.00
R6293:Lrch2 UTSW X 147480557 missense probably damaging 1.00
R6296:Lrch2 UTSW X 147480557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGGACCACTCAGAGT -3'
(R):5'- AAGAATGAGAACGGGACTCTC -3'

Sequencing Primer
(F):5'- GCTTGGACCACTCAGAGTTTATATC -3'
(R):5'- CTGTCTCAGCATTTTATTCAACT -3'
Posted On 2014-12-29