Incidental Mutation 'R2921:Hdc'
ID255508
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Namehistidine decarboxylase
SynonymsHdc-s, Hdc-a, Hdc-c, Hdc-e, L-histidine decarboxylase
MMRRC Submission 040506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R2921 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126593667-126619299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126593990 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 654 (P654S)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
Predicted Effect probably damaging
Transcript: ENSMUST00000028838
AA Change: P654S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: P654S

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124396
Meta Mutation Damage Score 0.1161 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Ralgps1 A T 2: 33,143,070 I449N probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc26a2 T A 18: 61,201,935 I149F probably damaging Het
Slc6a15 A G 10: 103,418,387 D728G probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Spatc1 T C 15: 76,283,925 S195P probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126601872 missense probably benign 0.00
IGL01024:Hdc APN 2 126603846 missense probably benign 0.32
IGL01393:Hdc APN 2 126594661 missense probably benign 0.28
IGL01802:Hdc APN 2 126603894 missense probably benign 0.04
IGL01958:Hdc APN 2 126594532 missense possibly damaging 0.87
IGL02193:Hdc APN 2 126601780 splice site probably benign
IGL02494:Hdc APN 2 126594121 missense probably benign
IGL02696:Hdc APN 2 126594300 missense probably damaging 1.00
IGL02874:Hdc APN 2 126601676 missense probably benign 0.21
R0453:Hdc UTSW 2 126594951 splice site probably benign
R0528:Hdc UTSW 2 126616232 missense probably benign 0.00
R1337:Hdc UTSW 2 126616276 missense probably benign
R1862:Hdc UTSW 2 126597933 missense probably benign 0.36
R1938:Hdc UTSW 2 126606397 missense possibly damaging 0.86
R1994:Hdc UTSW 2 126616187 missense probably damaging 1.00
R2230:Hdc UTSW 2 126594018 missense possibly damaging 0.65
R2257:Hdc UTSW 2 126616080 intron probably null
R2923:Hdc UTSW 2 126593990 missense probably damaging 1.00
R3620:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3621:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3914:Hdc UTSW 2 126603006 missense probably damaging 1.00
R4076:Hdc UTSW 2 126616261 missense possibly damaging 0.92
R4114:Hdc UTSW 2 126601818 missense probably benign 0.16
R4213:Hdc UTSW 2 126597866 splice site probably null
R4827:Hdc UTSW 2 126594313 missense probably benign
R4889:Hdc UTSW 2 126594133 missense probably benign 0.00
R5013:Hdc UTSW 2 126604300 missense probably benign 0.33
R5593:Hdc UTSW 2 126618584 utr 5 prime probably benign
R5604:Hdc UTSW 2 126594663 missense probably benign
R5637:Hdc UTSW 2 126616189 missense probably benign 0.02
R6211:Hdc UTSW 2 126593977 missense probably damaging 0.98
R6312:Hdc UTSW 2 126607406 missense possibly damaging 0.65
R7730:Hdc UTSW 2 126594082 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ATGCCCGCTTAAACTTCCCAG -3'
(R):5'- ATGAGTGCCCAGAAGTCAC -3'

Sequencing Primer
(F):5'- ATCTGTTGTGGATCACGAAGACCC -3'
(R):5'- GTGCCCAGAAGTCACTCCCC -3'
Posted On2014-12-29