Incidental Mutation 'R2921:Nipal3'
ID255518
Institutional Source Beutler Lab
Gene Symbol Nipal3
Ensembl Gene ENSMUSG00000028803
Gene NameNIPA-like domain containing 3
Synonyms9130020G22Rik, Npal3
MMRRC Submission 040506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2921 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135445420-135495038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135477465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 125 (I125N)
Ref Sequence ENSEMBL: ENSMUSP00000139088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102549] [ENSMUST00000105856] [ENSMUST00000145020] [ENSMUST00000183807]
Predicted Effect probably damaging
Transcript: ENSMUST00000102549
AA Change: I125N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099608
Gene: ENSMUSG00000028803
AA Change: I125N

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 5e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105856
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101482
Gene: ENSMUSG00000028803
AA Change: I125N

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:Mg_trans_NIPA 35 330 9.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140982
SMART Domains Protein: ENSMUSP00000118178
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 1 190 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145020
SMART Domains Protein: ENSMUSP00000118122
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 107 4.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183807
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139088
Gene: ENSMUSG00000028803
AA Change: I125N

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 3.8e-75 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit gender-dependent behavioral and immune system abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Ralgps1 A T 2: 33,143,070 I449N probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc26a2 T A 18: 61,201,935 I149F probably damaging Het
Slc6a15 A G 10: 103,418,387 D728G probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Spatc1 T C 15: 76,283,925 S195P probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Nipal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Nipal3 APN 4 135468593 missense possibly damaging 0.90
IGL01338:Nipal3 APN 4 135471883 critical splice donor site probably null
IGL02149:Nipal3 APN 4 135466852 missense possibly damaging 0.67
IGL02160:Nipal3 APN 4 135474417 nonsense probably null
IGL02560:Nipal3 APN 4 135479704 missense probably damaging 1.00
IGL02826:Nipal3 APN 4 135468550 nonsense probably null
IGL02868:Nipal3 APN 4 135466871 missense probably damaging 1.00
R0189:Nipal3 UTSW 4 135468518 missense possibly damaging 0.89
R0470:Nipal3 UTSW 4 135447372 missense probably damaging 0.99
R0891:Nipal3 UTSW 4 135468587 missense possibly damaging 0.91
R1633:Nipal3 UTSW 4 135447348 missense probably benign 0.03
R1686:Nipal3 UTSW 4 135447288 missense possibly damaging 0.49
R2923:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3733:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3734:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R5057:Nipal3 UTSW 4 135466856 missense probably damaging 1.00
R5616:Nipal3 UTSW 4 135452404 missense probably benign 0.01
R5758:Nipal3 UTSW 4 135452563 missense probably benign 0.02
R5779:Nipal3 UTSW 4 135452339 intron probably benign
R5885:Nipal3 UTSW 4 135471977 missense probably damaging 0.97
R6572:Nipal3 UTSW 4 135447253 missense probably benign 0.02
R6981:Nipal3 UTSW 4 135479547 missense probably damaging 1.00
R7194:Nipal3 UTSW 4 135474421 missense probably benign 0.26
R7537:Nipal3 UTSW 4 135490937 missense probably damaging 1.00
R8018:Nipal3 UTSW 4 135447348 missense possibly damaging 0.63
R8098:Nipal3 UTSW 4 135452398 missense possibly damaging 0.87
R8503:Nipal3 UTSW 4 135479581 missense probably damaging 1.00
X0066:Nipal3 UTSW 4 135447255 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTAATTTTCTACTGGGCCAC -3'
(R):5'- TCCCAGATGGAGAGTCTGAG -3'

Sequencing Primer
(F):5'- AGACAATTCTGATGGGTAGCTG -3'
(R):5'- TCTGAGGCTGAAGGAGAGC -3'
Posted On2014-12-29