Incidental Mutation 'R2921:Golga4'
ID255533
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Namegolgi autoantigen, golgin subfamily a, 4
Synonymsgolgin-245, Olp-1
MMRRC Submission 040506-MU
Accession Numbers

Genbank: NM_018748; MGI: 1859646  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2921 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location118506267-118582519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118559343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1844 (S1844R)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084820
AA Change: S1844R

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1844R

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000211840
AA Change: S854R
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Ralgps1 A T 2: 33,143,070 I449N probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc26a2 T A 18: 61,201,935 I149F probably damaging Het
Slc6a15 A G 10: 103,418,387 D728G probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Spatc1 T C 15: 76,283,925 S195P probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118514271 critical splice donor site probably null
IGL00801:Golga4 APN 9 118538926 missense probably damaging 0.98
IGL01395:Golga4 APN 9 118535373 missense probably damaging 1.00
IGL01472:Golga4 APN 9 118532574 missense probably damaging 1.00
IGL01519:Golga4 APN 9 118527092 missense probably damaging 1.00
IGL01563:Golga4 APN 9 118527006 splice site probably benign
IGL02593:Golga4 APN 9 118555566 unclassified probably benign
IGL02803:Golga4 APN 9 118535460 missense probably benign
IGL02939:Golga4 APN 9 118535454 missense probably benign 0.01
IGL02939:Golga4 APN 9 118534632 missense probably damaging 1.00
IGL03123:Golga4 APN 9 118536885 missense probably damaging 1.00
IGL03334:Golga4 APN 9 118537233 splice site probably benign
F5770:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118553457 missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118553453 missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118560740 critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118568993 missense probably benign 0.00
R0362:Golga4 UTSW 9 118555785 missense probably benign 0.13
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0974:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R1128:Golga4 UTSW 9 118548784 missense probably benign 0.40
R1384:Golga4 UTSW 9 118565651 missense probably damaging 0.99
R1435:Golga4 UTSW 9 118535440 missense probably benign 0.00
R1513:Golga4 UTSW 9 118555732 missense probably benign 0.02
R1818:Golga4 UTSW 9 118572987 missense probably damaging 1.00
R2083:Golga4 UTSW 9 118532590 missense probably damaging 1.00
R2243:Golga4 UTSW 9 118556904 missense probably benign 0.06
R2355:Golga4 UTSW 9 118560742 missense probably benign 0.00
R2518:Golga4 UTSW 9 118556612 missense probably damaging 1.00
R2922:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118557380 missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118534647 missense probably benign 0.16
R3909:Golga4 UTSW 9 118558736 missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118538971 missense probably damaging 0.99
R4321:Golga4 UTSW 9 118556435 missense probably damaging 1.00
R4358:Golga4 UTSW 9 118551878 missense probably benign 0.16
R4483:Golga4 UTSW 9 118514186 missense probably damaging 1.00
R4515:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4518:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4519:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4545:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4546:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4580:Golga4 UTSW 9 118557259 missense probably benign 0.00
R4918:Golga4 UTSW 9 118558145 missense probably damaging 1.00
R5007:Golga4 UTSW 9 118558300 missense probably benign
R5045:Golga4 UTSW 9 118565656 missense probably benign
R5232:Golga4 UTSW 9 118506558 critical splice donor site probably null
R5256:Golga4 UTSW 9 118556501 missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118559057 nonsense probably null
R5567:Golga4 UTSW 9 118558183 missense probably damaging 1.00
R5576:Golga4 UTSW 9 118553534 missense probably benign 0.13
R5771:Golga4 UTSW 9 118558283 missense probably damaging 0.96
R5807:Golga4 UTSW 9 118527130 missense probably damaging 0.99
R5860:Golga4 UTSW 9 118558106 missense probably damaging 1.00
R6012:Golga4 UTSW 9 118559696 missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118558627 nonsense probably null
R6299:Golga4 UTSW 9 118557370 missense probably benign 0.03
R6467:Golga4 UTSW 9 118536792 missense probably damaging 1.00
R6552:Golga4 UTSW 9 118514231 missense probably damaging 1.00
R6688:Golga4 UTSW 9 118514210 missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118548779 missense probably damaging 1.00
R6987:Golga4 UTSW 9 118558532 missense probably benign
R7212:Golga4 UTSW 9 118536840 missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118559495 missense probably benign
R7431:Golga4 UTSW 9 118559731 missense probably damaging 1.00
R7641:Golga4 UTSW 9 118557575 missense probably benign 0.05
R7727:Golga4 UTSW 9 118548702 missense probably damaging 1.00
R7729:Golga4 UTSW 9 118556063 missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118532575 missense probably damaging 1.00
R7849:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118556366 missense probably damaging 1.00
R7932:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7974:Golga4 UTSW 9 118556366 missense probably damaging 1.00
RF022:Golga4 UTSW 9 118557989 missense probably damaging 1.00
V7583:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGCTCTCTGGAAAGTTAGACTGC -3'
(R):5'- TTGGGAGTTTTCCTCAGGCC -3'

Sequencing Primer
(F):5'- CTCTCTGGAAAGTTAGACTGCACTAG -3'
(R):5'- CAGGCCTGTCTTCCAACAC -3'
Posted On2014-12-29