Incidental Mutation 'R2921:Hivep2'
ID255534
Institutional Source Beutler Lab
Gene Symbol Hivep2
Ensembl Gene ENSMUSG00000015501
Gene Namehuman immunodeficiency virus type I enhancer binding protein 2
SynonymsShn-2, MIBP1, Schnurri-2, Gm20114
MMRRC Submission 040506-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R2921 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location13966075-14151374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14128969 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 437 (T437K)
Ref Sequence ENSEMBL: ENSMUSP00000140150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015645] [ENSMUST00000186989] [ENSMUST00000187083] [ENSMUST00000191138]
Predicted Effect probably benign
Transcript: ENSMUST00000015645
AA Change: T437K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000015645
Gene: ENSMUSG00000015501
AA Change: T437K

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186989
SMART Domains Protein: ENSMUSP00000140180
Gene: ENSMUSG00000015501

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 7.9e-6 SMART
ZnF_C2H2 217 239 3.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187083
AA Change: T437K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140290
Gene: ENSMUSG00000015501
AA Change: T437K

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191138
AA Change: T437K

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140150
Gene: ENSMUSG00000015501
AA Change: T437K

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of closely related, large, zinc finger-containing transcription factors. The encoded protein regulates transcription by binding to regulatory regions of various cellular and viral genes that maybe involved in growth, development and metastasis. The protein contains the ZAS domain comprised of two widely separated regions of zinc finger motifs, a stretch of highly acidic amino acids and a serine/threonine-rich sequence. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal thymus anatomy, severely defective positive selection of CD4+ and CD8+ cells, and enhanced T-helper 2 cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Ralgps1 A T 2: 33,143,070 I449N probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc26a2 T A 18: 61,201,935 I149F probably damaging Het
Slc6a15 A G 10: 103,418,387 D728G probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Spatc1 T C 15: 76,283,925 S195P probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Hivep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Hivep2 APN 10 14142244 missense probably damaging 1.00
IGL00963:Hivep2 APN 10 14129347 missense probably damaging 1.00
IGL01066:Hivep2 APN 10 14149024 missense possibly damaging 0.92
IGL01395:Hivep2 APN 10 14132800 critical splice donor site probably null
IGL01474:Hivep2 APN 10 14143662 missense probably damaging 1.00
IGL01481:Hivep2 APN 10 14149237 missense probably benign
IGL01597:Hivep2 APN 10 14149374 nonsense probably null
IGL01719:Hivep2 APN 10 14130523 missense probably damaging 1.00
IGL01952:Hivep2 APN 10 14142331 missense possibly damaging 0.54
IGL02170:Hivep2 APN 10 14127804 missense possibly damaging 0.46
IGL02315:Hivep2 APN 10 14131239 missense probably benign 0.01
IGL02517:Hivep2 APN 10 14131182 missense probably benign 0.01
IGL02535:Hivep2 APN 10 14139497 missense probably damaging 1.00
IGL02539:Hivep2 APN 10 14131878 missense probably damaging 0.97
IGL02637:Hivep2 APN 10 14130708 missense possibly damaging 0.89
IGL02715:Hivep2 APN 10 14131387 missense probably benign 0.03
IGL02948:Hivep2 APN 10 14129013 missense probably benign 0.44
IGL03113:Hivep2 APN 10 14130651 missense probably damaging 1.00
IGL03161:Hivep2 APN 10 14143356 missense probably damaging 1.00
IGL03173:Hivep2 APN 10 14127982 missense possibly damaging 0.75
IGL03310:Hivep2 APN 10 14143667 missense probably damaging 1.00
R0005:Hivep2 UTSW 10 14128749 missense probably damaging 0.99
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0136:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R0143:Hivep2 UTSW 10 14129355 missense probably damaging 1.00
R0172:Hivep2 UTSW 10 14139474 missense probably damaging 1.00
R0226:Hivep2 UTSW 10 14129712 missense probably benign 0.26
R0348:Hivep2 UTSW 10 14129958 missense possibly damaging 0.76
R0352:Hivep2 UTSW 10 14143295 missense possibly damaging 0.74
R0657:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R1710:Hivep2 UTSW 10 14129505 nonsense probably null
R1959:Hivep2 UTSW 10 14132709 missense probably benign 0.02
R2017:Hivep2 UTSW 10 14130757 missense probably damaging 0.96
R2085:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2085:Hivep2 UTSW 10 14139529 nonsense probably null
R2163:Hivep2 UTSW 10 14128226 nonsense probably null
R2206:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2207:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2228:Hivep2 UTSW 10 14128363 missense probably damaging 1.00
R2241:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2242:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2243:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2246:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2247:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2273:Hivep2 UTSW 10 14132443 missense probably benign 0.02
R2357:Hivep2 UTSW 10 14143299 missense probably benign 0.01
R2517:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2519:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2858:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2859:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2916:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3051:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3177:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3277:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3620:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3621:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3701:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3802:Hivep2 UTSW 10 14148961 missense possibly damaging 0.94
R3810:Hivep2 UTSW 10 14130357 missense probably benign
R3811:Hivep2 UTSW 10 14130357 missense probably benign
R3817:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3818:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3819:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3836:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3837:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3838:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3839:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3897:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3900:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3932:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3954:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3957:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4001:Hivep2 UTSW 10 14127732 missense probably damaging 1.00
R4134:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4180:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4248:Hivep2 UTSW 10 14131555 missense probably damaging 1.00
R4416:Hivep2 UTSW 10 14129170 missense probably benign
R4436:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4437:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4474:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4475:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4476:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4636:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4637:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4791:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4792:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4825:Hivep2 UTSW 10 14131319 missense possibly damaging 0.81
R4955:Hivep2 UTSW 10 14130958 missense probably benign 0.44
R5094:Hivep2 UTSW 10 14132149 missense probably benign
R5129:Hivep2 UTSW 10 14130864 missense probably damaging 1.00
R5163:Hivep2 UTSW 10 14139425 missense probably damaging 1.00
R5255:Hivep2 UTSW 10 14131267 unclassified probably null
R5330:Hivep2 UTSW 10 14131420 missense probably damaging 1.00
R5341:Hivep2 UTSW 10 14132592 missense possibly damaging 0.94
R5453:Hivep2 UTSW 10 14128228 missense possibly damaging 0.78
R5513:Hivep2 UTSW 10 14132673 nonsense probably null
R5535:Hivep2 UTSW 10 14131022 missense probably benign 0.00
R5613:Hivep2 UTSW 10 14139495 missense probably damaging 1.00
R5804:Hivep2 UTSW 10 14133775 missense probably benign 0.01
R6074:Hivep2 UTSW 10 14131741 missense probably benign 0.18
R6163:Hivep2 UTSW 10 14129992 missense probably damaging 0.98
R6250:Hivep2 UTSW 10 14131759 missense probably benign 0.01
R6696:Hivep2 UTSW 10 14133759 missense probably benign 0.06
R6754:Hivep2 UTSW 10 14129638 missense probably benign 0.06
R6756:Hivep2 UTSW 10 14132559 missense probably damaging 1.00
R6799:Hivep2 UTSW 10 14129013 missense probably benign 0.28
R6862:Hivep2 UTSW 10 14130583 missense probably damaging 1.00
R6932:Hivep2 UTSW 10 14128501 missense probably damaging 1.00
R6943:Hivep2 UTSW 10 14128314 missense probably damaging 1.00
R7027:Hivep2 UTSW 10 14149577 missense probably damaging 0.99
R7027:Hivep2 UTSW 10 14149578 missense probably damaging 1.00
R7198:Hivep2 UTSW 10 14129966 missense probably benign
R7248:Hivep2 UTSW 10 14131165 missense possibly damaging 0.86
R7256:Hivep2 UTSW 10 14129101 missense probably benign 0.29
R7426:Hivep2 UTSW 10 14131317 missense possibly damaging 0.93
R7427:Hivep2 UTSW 10 14133741 missense possibly damaging 0.94
R7638:Hivep2 UTSW 10 14143851 missense possibly damaging 0.81
R7731:Hivep2 UTSW 10 14149714 missense probably benign
R7740:Hivep2 UTSW 10 14127670 missense probably damaging 1.00
R7797:Hivep2 UTSW 10 14130103 missense probably benign
Z1177:Hivep2 UTSW 10 14131786 missense probably damaging 1.00
Z1177:Hivep2 UTSW 10 14143307 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGACTCTCACACGGTGAAAC -3'
(R):5'- AACATGTTGATTTGACCGGGG -3'

Sequencing Primer
(F):5'- AAACTTGCGCTGAGACTGTC -3'
(R):5'- ATTTGACCGGGGTCCATTTC -3'
Posted On2014-12-29