Incidental Mutation 'R2921:Slc6a15'
ID 255537
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 040506-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2921 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 103367783-103419377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103418387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 728 (D728G)
Ref Sequence ENSEMBL: ENSMUSP00000136676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: D728G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: D728G

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: D728G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: D728G

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Ralgps1 A T 2: 33,143,070 I449N probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc26a2 T A 18: 61,201,935 I149F probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Spatc1 T C 15: 76,283,925 S195P probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5320:Slc6a15 UTSW 10 103408206 missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103404367 missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103408302 missense probably benign
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R7948:Slc6a15 UTSW 10 103404295 missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103394029 critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103389187 missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103409695 missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103389251 missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103404315 missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103389318 missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103393496 missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103395092 nonsense probably null
R9050:Slc6a15 UTSW 10 103416655 missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103400279 missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103393545 nonsense probably null
R9493:Slc6a15 UTSW 10 103393416 missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103404722 missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103404472 missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103400216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGCAAGCCTCATTCATGG -3'
(R):5'- TCCTGGCAAAATATGACCTCAGTC -3'

Sequencing Primer
(F):5'- CCTCATTCATGGAAAGATACCGAGTG -3'
(R):5'- GACCTCAGTCAATGTAAGCTTTGTC -3'
Posted On 2014-12-29