Incidental Mutation 'R2921:Slc6a15'
ID 255537
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission 040506-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2921 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 103203644-103255238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103254248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 728 (D728G)
Ref Sequence ENSEMBL: ENSMUSP00000136676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect probably damaging
Transcript: ENSMUST00000074204
AA Change: D728G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: D728G

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179636
AA Change: D728G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: D728G

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,393 (GRCm39) D90G possibly damaging Het
Adipor1 T C 1: 134,353,731 (GRCm39) V172A possibly damaging Het
Akt2 A G 7: 27,328,411 (GRCm39) K146R probably benign Het
Atg4a T C X: 139,941,768 (GRCm39) V284A possibly damaging Het
Atp6v0a2 C T 5: 124,794,981 (GRCm39) T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Ccdc116 T C 16: 16,960,307 (GRCm39) H170R probably benign Het
Ccn5 G A 2: 163,674,266 (GRCm39) R222Q probably benign Het
Cemip2 A G 19: 21,795,303 (GRCm39) D732G possibly damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Dpm3 C T 3: 89,174,062 (GRCm39) L8F probably damaging Het
Fhl3 T C 4: 124,599,463 (GRCm39) S13P probably damaging Het
Fndc1 A G 17: 8,023,707 (GRCm39) S83P probably damaging Het
Gapvd1 A T 2: 34,578,875 (GRCm39) I1249N probably damaging Het
Gbp7 A T 3: 142,240,333 (GRCm39) E17V probably benign Het
Gm57858 T C 3: 36,080,077 (GRCm39) M227V probably null Het
Golga4 T A 9: 118,388,411 (GRCm39) S1844R possibly damaging Het
Grm7 T A 6: 111,472,866 (GRCm39) probably null Het
Hdc G A 2: 126,435,910 (GRCm39) P654S probably damaging Het
Hgd T C 16: 37,439,330 (GRCm39) F213L probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hoxb1 T C 11: 96,257,119 (GRCm39) L156P probably benign Het
Mboat2 T A 12: 25,004,239 (GRCm39) W347R probably damaging Het
Mlkl T C 8: 112,043,079 (GRCm39) E356G probably benign Het
Ncor2 A G 5: 125,132,855 (GRCm39) F44S probably damaging Het
Nipal3 A T 4: 135,204,776 (GRCm39) I125N probably damaging Het
Nr1h4 A T 10: 89,334,223 (GRCm39) Y42N probably damaging Het
Nup155 A C 15: 8,183,125 (GRCm39) E1228D probably damaging Het
Or4c113 A G 2: 88,884,843 (GRCm39) V309A probably benign Het
Pde4dip T C 3: 97,626,885 (GRCm39) N1218D probably benign Het
Ralgps1 A T 2: 33,033,082 (GRCm39) I449N probably damaging Het
Rdm1 T A 11: 101,521,716 (GRCm39) L157H possibly damaging Het
Rfx7 G A 9: 72,524,946 (GRCm39) G712D possibly damaging Het
Rnf151 C T 17: 24,935,235 (GRCm39) G232D possibly damaging Het
Rpl22 C A 4: 152,412,002 (GRCm39) T26N possibly damaging Het
Rptn A G 3: 93,306,015 (GRCm39) Y1116C possibly damaging Het
Safb2 A G 17: 56,875,906 (GRCm39) V89A possibly damaging Het
Setx TGTGG TG 2: 29,044,072 (GRCm39) probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc24a2 A G 4: 86,909,591 (GRCm39) V660A possibly damaging Het
Slc26a2 T A 18: 61,335,007 (GRCm39) I149F probably damaging Het
Slfn3 A G 11: 83,105,871 (GRCm39) M623V probably benign Het
Smim1 A G 4: 154,108,097 (GRCm39) probably benign Het
Spatc1 T C 15: 76,168,125 (GRCm39) S195P probably damaging Het
Tmx1 T A 12: 70,512,895 (GRCm39) C268S probably benign Het
Trpc6 A T 9: 8,653,034 (GRCm39) L613F possibly damaging Het
Vmn2r60 T A 7: 41,790,459 (GRCm39) V482E probably damaging Het
Zdhhc18 G T 4: 133,360,455 (GRCm39) H82Q probably benign Het
Zfp507 T C 7: 35,494,224 (GRCm39) E273G probably damaging Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103,225,002 (GRCm39) missense probably benign
IGL01320:Slc6a15 APN 10 103,240,606 (GRCm39) missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103,240,686 (GRCm39) splice site probably null
IGL02066:Slc6a15 APN 10 103,252,519 (GRCm39) missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103,254,083 (GRCm39) missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103,240,136 (GRCm39) splice site probably benign
IGL02744:Slc6a15 APN 10 103,253,894 (GRCm39) missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103,252,541 (GRCm39) missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103,253,929 (GRCm39) missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103,225,208 (GRCm39) splice site probably benign
R0165:Slc6a15 UTSW 10 103,245,670 (GRCm39) missense probably null 0.04
R0349:Slc6a15 UTSW 10 103,254,086 (GRCm39) missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103,253,914 (GRCm39) missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103,240,213 (GRCm39) nonsense probably null
R0784:Slc6a15 UTSW 10 103,252,661 (GRCm39) splice site probably benign
R0944:Slc6a15 UTSW 10 103,245,657 (GRCm39) missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103,236,121 (GRCm39) missense probably benign
R1882:Slc6a15 UTSW 10 103,230,925 (GRCm39) missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103,245,595 (GRCm39) missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103,229,269 (GRCm39) missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103,252,646 (GRCm39) missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103,240,552 (GRCm39) missense probably benign 0.01
R3709:Slc6a15 UTSW 10 103,229,275 (GRCm39) missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103,245,648 (GRCm39) missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103,253,921 (GRCm39) missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103,240,275 (GRCm39) missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103,225,087 (GRCm39) missense probably benign
R5320:Slc6a15 UTSW 10 103,244,067 (GRCm39) missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103,229,369 (GRCm39) missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103,225,031 (GRCm39) missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103,240,228 (GRCm39) missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103,229,775 (GRCm39) missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103,230,928 (GRCm39) missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103,244,163 (GRCm39) missense probably benign
R7549:Slc6a15 UTSW 10 103,224,998 (GRCm39) missense probably benign
R7660:Slc6a15 UTSW 10 103,229,241 (GRCm39) splice site probably null
R7839:Slc6a15 UTSW 10 103,240,660 (GRCm39) missense probably benign
R7948:Slc6a15 UTSW 10 103,240,156 (GRCm39) missense possibly damaging 0.95
R8278:Slc6a15 UTSW 10 103,229,890 (GRCm39) critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103,225,048 (GRCm39) missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103,245,556 (GRCm39) missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103,225,112 (GRCm39) missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103,240,176 (GRCm39) missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103,225,179 (GRCm39) missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103,229,357 (GRCm39) missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103,230,953 (GRCm39) nonsense probably null
R9050:Slc6a15 UTSW 10 103,252,516 (GRCm39) missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103,236,140 (GRCm39) missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103,229,406 (GRCm39) nonsense probably null
R9493:Slc6a15 UTSW 10 103,229,277 (GRCm39) missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103,240,583 (GRCm39) missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103,240,333 (GRCm39) missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103,236,077 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGCAAGCCTCATTCATGG -3'
(R):5'- TCCTGGCAAAATATGACCTCAGTC -3'

Sequencing Primer
(F):5'- CCTCATTCATGGAAAGATACCGAGTG -3'
(R):5'- GACCTCAGTCAATGTAAGCTTTGTC -3'
Posted On 2014-12-29