Incidental Mutation 'R2921:Spatc1'
ID255546
Institutional Source Beutler Lab
Gene Symbol Spatc1
Ensembl Gene ENSMUSG00000049653
Gene Namespermatogenesis and centriole associated 1
Synonymssperiolin, 1700084J23Rik
MMRRC Submission 040506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2921 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76268089-76292572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76283925 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 195 (S195P)
Ref Sequence ENSEMBL: ENSMUSP00000155378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074173] [ENSMUST00000230221]
Predicted Effect probably damaging
Transcript: ENSMUST00000074173
AA Change: S195P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073805
Gene: ENSMUSG00000049653
AA Change: S195P

DomainStartEndE-ValueType
Pfam:Speriolin_N 1 176 5.1e-67 PFAM
Pfam:Speriolin_N 172 262 1.2e-25 PFAM
Pfam:Speriolin_C 334 480 1.5e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230221
AA Change: S195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Ralgps1 A T 2: 33,143,070 I449N probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc26a2 T A 18: 61,201,935 I149F probably damaging Het
Slc6a15 A G 10: 103,418,387 D728G probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Spatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Spatc1 APN 15 76284794 missense probably damaging 1.00
IGL02215:Spatc1 APN 15 76283539 splice site probably benign
IGL02678:Spatc1 APN 15 76292372 missense probably damaging 1.00
R0452:Spatc1 UTSW 15 76268293 missense probably damaging 1.00
R1972:Spatc1 UTSW 15 76284875 intron probably null
R2066:Spatc1 UTSW 15 76283537 splice site probably null
R3689:Spatc1 UTSW 15 76268295 nonsense probably null
R3690:Spatc1 UTSW 15 76268295 nonsense probably null
R4519:Spatc1 UTSW 15 76292485 missense probably damaging 1.00
R5944:Spatc1 UTSW 15 76283938 missense probably damaging 1.00
R7008:Spatc1 UTSW 15 76283723 missense probably benign 0.00
R7034:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7036:Spatc1 UTSW 15 76283880 missense probably benign 0.00
R7436:Spatc1 UTSW 15 76268368 missense probably benign 0.21
X0023:Spatc1 UTSW 15 76268372 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGCTGCTACTCTTAACCCAC -3'
(R):5'- TTGGGCACTACGTTCTGAGC -3'

Sequencing Primer
(F):5'- GGCCAAATACCCTTGTTGCAG -3'
(R):5'- TACGTTCTGAGCAACACCTAGAGG -3'
Posted On2014-12-29