Incidental Mutation 'R2921:Slc26a2'
ID255554
Institutional Source Beutler Lab
Gene Symbol Slc26a2
Ensembl Gene ENSMUSG00000034320
Gene Namesolute carrier family 26 (sulfate transporter), member 2
SynonymsDtd, ST-OB
MMRRC Submission 040506-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R2921 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61192919-61211612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61201935 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 149 (I149F)
Ref Sequence ENSEMBL: ENSMUSP00000114419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037603] [ENSMUST00000146409] [ENSMUST00000148829]
Predicted Effect probably benign
Transcript: ENSMUST00000037603
SMART Domains Protein: ENSMUSP00000040163
Gene: ENSMUSG00000034320

DomainStartEndE-ValueType
Pfam:Sulfate_transp 1 279 5.8e-83 PFAM
low complexity region 317 330 N/A INTRINSIC
Pfam:STAS 334 480 5.8e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146409
AA Change: I149F

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119447
Gene: ENSMUSG00000034320
AA Change: I149F

DomainStartEndE-ValueType
Pfam:Sulfate_transp 108 518 1.8e-133 PFAM
low complexity region 552 565 N/A INTRINSIC
Pfam:STAS 569 715 2.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148829
AA Change: I149F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114419
Gene: ENSMUSG00000034320
AA Change: I149F

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 93 176 1.1e-33 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The diastrophic dysplasia sulfate transporter is a transmembrane glycoprotein implicated in the pathogenesis of several human chondrodysplasias. It apparently is critical in cartilage for sulfation of proteoglycans and matrix organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit premature death, stunted growth, joint contractures, and skeletal dysplasia including kyphosis, shorter osteoporotic long bones, aberrant chondrocyte size, delayed endochondral bone ossification, and impairedchondrocyte proliferation and sulfate uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Ralgps1 A T 2: 33,143,070 I449N probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc6a15 A G 10: 103,418,387 D728G probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Spatc1 T C 15: 76,283,925 S195P probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Slc26a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slc26a2 APN 18 61198740 missense probably benign 0.05
IGL01570:Slc26a2 APN 18 61198260 missense possibly damaging 0.80
IGL01800:Slc26a2 APN 18 61201729 nonsense probably null
IGL02131:Slc26a2 APN 18 61198812 missense possibly damaging 0.69
IGL02277:Slc26a2 APN 18 61198980 missense probably damaging 1.00
IGL02438:Slc26a2 APN 18 61202217 missense possibly damaging 0.46
IGL03338:Slc26a2 APN 18 61198902 missense probably damaging 1.00
IGL03377:Slc26a2 APN 18 61198586 missense probably damaging 1.00
R0029:Slc26a2 UTSW 18 61202310 missense possibly damaging 0.73
R0531:Slc26a2 UTSW 18 61198379 missense probably damaging 1.00
R1929:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R2115:Slc26a2 UTSW 18 61198824 missense possibly damaging 0.71
R2272:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R4184:Slc26a2 UTSW 18 61198832 missense probably benign 0.01
R4765:Slc26a2 UTSW 18 61199486 missense probably damaging 0.97
R4812:Slc26a2 UTSW 18 61202021 missense probably damaging 1.00
R4948:Slc26a2 UTSW 18 61198258 nonsense probably null
R4960:Slc26a2 UTSW 18 61198803 missense probably damaging 1.00
R5107:Slc26a2 UTSW 18 61198560 missense probably damaging 1.00
R6120:Slc26a2 UTSW 18 61199417 missense possibly damaging 0.64
R6147:Slc26a2 UTSW 18 61201685 missense probably damaging 1.00
R6914:Slc26a2 UTSW 18 61199279 missense probably damaging 0.97
R6996:Slc26a2 UTSW 18 61201854 missense probably damaging 1.00
R7166:Slc26a2 UTSW 18 61198829 missense possibly damaging 0.88
R7529:Slc26a2 UTSW 18 61198358 missense probably damaging 1.00
R7609:Slc26a2 UTSW 18 61198460 missense probably benign 0.00
R7846:Slc26a2 UTSW 18 61198704 missense probably benign 0.00
R7929:Slc26a2 UTSW 18 61198704 missense probably benign 0.00
X0003:Slc26a2 UTSW 18 61199195 missense probably damaging 0.99
Z1177:Slc26a2 UTSW 18 61199537 missense not run
Predicted Primers PCR Primer
(F):5'- CATAGCAGCTTTTATCACAGAGTCC -3'
(R):5'- AGTCAGAGACGGGGCTTTTG -3'

Sequencing Primer
(F):5'- CACAGAGTCCGTCTAATGTATGG -3'
(R):5'- CAGAGACGGGGCTTTTGATTTC -3'
Posted On2014-12-29