Mutagenetix > Incidental Mutation

Incidental Mutation 'R2922:Kcnn3'

255562

Institutional Source

Beutler Lab

Gene Symbol

Kcnn3

Ensembl Gene

ENSMUSG00000000794

Gene Name

potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3

Synonyms

small conductance calcium-activated potassium channel 3, SK3

MMRRC Submission

040507-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.598) question?

Stock #

R2922 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89520164-89675132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89521022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 185 (V185A)

Ref Sequence

ENSEMBL: ENSMUSP00000000811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000811]

AlphaFold

P58391

Predicted Effect

probably damaging
Transcript: ENSMUST00000000811
AA Change: V185A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: V185A

Domain	Start	End	E-Value	Type
low complexity region	30	96	N/A	INTRINSIC
low complexity region	139	154	N/A	INTRINSIC
low complexity region	213	224	N/A	INTRINSIC
Pfam:SK_channel	270	383	3.1e-51	PFAM
Pfam:Ion_trans_2	462	548	2.2e-14	PFAM
CaMBD	562	638	1.04e-49	SMART
low complexity region	684	690	N/A	INTRINSIC
low complexity region	718	731	N/A	INTRINSIC

Meta Mutation Damage Score

0.0817

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,861,534	D90G	possibly damaging	Het
Atp6v0a2	C	T	5: 124,717,917	T656M	possibly damaging	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Bsn	C	T	9: 108,108,186	V2890M	unknown	Het
Bsn	T	C	9: 108,115,469	E1028G	probably damaging	Het
Ccdc116	T	C	16: 17,142,443	H170R	probably benign	Het
Cdk11b	CAGAAGAAG	CAGAAG	4: 155,640,744		probably benign	Het
Clpb	A	G	7: 101,722,828	D257G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Dlgap5	A	G	14: 47,390,441		probably null	Het
Dmwd	T	C	7: 19,076,345	F26L	probably damaging	Het
Eif5b	T	C	1: 38,018,019		probably benign	Het
Flii	A	G	11: 60,718,916	Y622H	probably damaging	Het
Gbp7	A	T	3: 142,534,572	E17V	probably benign	Het
Ghrh	T	C	2: 157,331,877		probably null	Het
Gm20939	T	A	17: 94,877,293	H456Q	probably damaging	Het
Golga4	T	A	9: 118,559,343	S1844R	possibly damaging	Het
Hgd	T	C	16: 37,618,968	F213L	probably damaging	Het
Hoxb1	T	C	11: 96,366,293	L156P	probably benign	Het
Itga11	A	G	9: 62,768,630		probably benign	Het
Lrriq1	T	C	10: 103,214,675	T739A	probably benign	Het
Mib1	C	T	18: 10,760,831	Q374*	probably null	Het
Myh9	A	G	15: 77,813,184	L10P	probably damaging	Het
Ncor2	A	G	5: 125,055,791	F44S	probably damaging	Het
Nr3c1	C	A	18: 39,487,103	A44S	possibly damaging	Het
Olfr148	G	A	9: 39,613,764	V66I	probably benign	Het
Olfr644	A	G	7: 104,068,587	V148A	probably benign	Het
Ovch2	A	G	7: 107,790,389	L317P	possibly damaging	Het
Pcolce2	T	A	9: 95,694,714	L346Q	probably damaging	Het
Rdm1	T	A	11: 101,630,890	L157H	possibly damaging	Het
Rptn	A	G	3: 93,398,708	Y1116C	possibly damaging	Het
Scn7a	A	G	2: 66,700,207		probably benign	Het
Slc24a2	A	G	4: 86,991,354	V660A	possibly damaging	Het
Tet3	A	G	6: 83,368,512	S1648P	probably damaging	Het
Tmem198b	G	A	10: 128,802,193	T167I	probably damaging	Het
Tmem2	A	G	19: 21,817,939	D732G	possibly damaging	Het
Tmx1	T	A	12: 70,466,121	C268S	probably benign	Het
Ubr4	A	G	4: 139,479,500	N4886S	possibly damaging	Het
Usp47	A	G	7: 112,093,198	S956G	probably damaging	Het
Vmn2r60	T	A	7: 42,141,035	V482E	probably damaging	Het
Zfhx4	C	T	3: 5,403,664	P2986S	probably damaging	Het
Zfp507	T	C	7: 35,794,799	E273G	probably damaging	Het

Other mutations in Kcnn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02263:Kcnn3	APN	3	89661218	missense	possibly damaging	0.73
IGL02444:Kcnn3	APN	3	89652052	missense	possibly damaging	0.50
IGL02500:Kcnn3	APN	3	89661112	splice site	probably benign
IGL02814:Kcnn3	APN	3	89521175	missense	possibly damaging	0.94
IGL02821:Kcnn3	APN	3	89662722	missense	possibly damaging	0.84
IGL02821:Kcnn3	APN	3	89520974	missense	possibly damaging	0.91
IGL02852:Kcnn3	APN	3	89609616	missense	probably damaging	0.96
IGL02942:Kcnn3	APN	3	89652076	missense	probably benign	0.00
IGL03118:Kcnn3	APN	3	89667161	missense	probably damaging	1.00
R0015:Kcnn3	UTSW	3	89662773	missense	probably damaging	1.00
R0015:Kcnn3	UTSW	3	89662773	missense	probably damaging	1.00
R0032:Kcnn3	UTSW	3	89520665	small deletion	probably benign
R0370:Kcnn3	UTSW	3	89667092	missense	probably damaging	0.98
R0619:Kcnn3	UTSW	3	89652030	missense	probably damaging	1.00
R1167:Kcnn3	UTSW	3	89564952	nonsense	probably null
R1255:Kcnn3	UTSW	3	89652109	missense	possibly damaging	0.84
R1643:Kcnn3	UTSW	3	89520497	missense	unknown
R1733:Kcnn3	UTSW	3	89652090	missense	probably benign	0.00
R1793:Kcnn3	UTSW	3	89609405	missense	probably benign	0.20
R1827:Kcnn3	UTSW	3	89520994	missense	possibly damaging	0.75
R1899:Kcnn3	UTSW	3	89520455	start gained	probably benign
R2055:Kcnn3	UTSW	3	89521375	missense	probably damaging	1.00
R2843:Kcnn3	UTSW	3	89520665	small deletion	probably benign
R4078:Kcnn3	UTSW	3	89661188	missense	possibly damaging	0.68
R4227:Kcnn3	UTSW	3	89521175	missense	possibly damaging	0.94
R4604:Kcnn3	UTSW	3	89520420	start gained	probably benign
R4814:Kcnn3	UTSW	3	89662724	missense	probably damaging	1.00
R4822:Kcnn3	UTSW	3	89667289	missense	possibly damaging	0.93
R5175:Kcnn3	UTSW	3	89609439	missense	probably damaging	1.00
R5211:Kcnn3	UTSW	3	89521231	missense	probably benign	0.04
R5438:Kcnn3	UTSW	3	89521298	missense	probably damaging	1.00
R5496:Kcnn3	UTSW	3	89609490	missense	possibly damaging	0.95
R6244:Kcnn3	UTSW	3	89645523	nonsense	probably null
R7391:Kcnn3	UTSW	3	89609471	missense	probably benign	0.34
R7625:Kcnn3	UTSW	3	89609670	missense	probably damaging	0.99
R7834:Kcnn3	UTSW	3	89521354	missense	probably damaging	1.00
R8022:Kcnn3	UTSW	3	89609703	missense	possibly damaging	0.92
R8110:Kcnn3	UTSW	3	89661233	missense	probably damaging	0.99
R8220:Kcnn3	UTSW	3	89661241	missense	probably benign	0.14
R8787:Kcnn3	UTSW	3	89645450	missense	possibly damaging	0.93
R9124:Kcnn3	UTSW	3	89521229	missense	possibly damaging	0.47
R9256:Kcnn3	UTSW	3	89667100	missense	probably damaging	1.00
R9612:Kcnn3	UTSW	3	89609396	missense	probably benign	0.09
Z1088:Kcnn3	UTSW	3	89667130	missense	probably damaging	1.00
Z1177:Kcnn3	UTSW	3	89520923	missense	probably damaging	1.00
Z1177:Kcnn3	UTSW	3	89661136	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GGCAGCCAGCTAAATCTCAATG -3'
(R):5'- GTGTCCCAGCTTATAGCCAATG -3'

Sequencing Primer
(F):5'- AAATCTCAATGACCACTTGCTTGGC -3'
(R):5'- GTCCCAGCTTATAGCCAATGTTTTG -3'

Posted On

2014-12-29