Incidental Mutation 'R2922:Slc24a2'
ID 255565
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Name solute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms 6330417K15Rik
MMRRC Submission 040507-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R2922 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 86983124-87230477 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86991354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 660 (V660A)
Ref Sequence ENSEMBL: ENSMUSP00000043937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
AlphaFold Q14BI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000044990
AA Change: V660A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: V660A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107155
AA Change: V643A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: V643A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107157
AA Change: V664A

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: V664A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107158
AA Change: V709A

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: V709A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140780
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87227796 missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87227146 missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87226906 missense probably benign 0.00
G1patch:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
PIT4403001:Slc24a2 UTSW 4 87032286 missense probably benign 0.45
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0372:Slc24a2 UTSW 4 87227292 missense probably damaging 1.00
R1034:Slc24a2 UTSW 4 87032275 missense probably damaging 0.99
R1577:Slc24a2 UTSW 4 86991411 missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87176289 missense probably benign 0.01
R1955:Slc24a2 UTSW 4 87073244 missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 87011646 missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86991355 missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2924:Slc24a2 UTSW 4 87011724 missense probably benign 0.34
R3806:Slc24a2 UTSW 4 87227784 missense possibly damaging 0.92
R3933:Slc24a2 UTSW 4 87176185 missense probably benign
R4052:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4207:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87227862 utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86991478 missense possibly damaging 0.91
R4561:Slc24a2 UTSW 4 87227397 missense probably damaging 1.00
R4808:Slc24a2 UTSW 4 87032238 missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86991508 missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87226908 missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87227347 missense probably damaging 1.00
R5035:Slc24a2 UTSW 4 87011706 missense possibly damaging 0.48
R5171:Slc24a2 UTSW 4 86996634 missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86991388 missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 87011588 splice site probably null
R6046:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87176292 missense probably benign
R7087:Slc24a2 UTSW 4 86991219 splice site probably null
R7804:Slc24a2 UTSW 4 86991537 missense probably damaging 1.00
R8003:Slc24a2 UTSW 4 87176315 missense probably benign 0.04
R8058:Slc24a2 UTSW 4 86991513 missense probably damaging 1.00
R8428:Slc24a2 UTSW 4 87227100 missense probably damaging 1.00
R8529:Slc24a2 UTSW 4 87028280 missense possibly damaging 0.51
R9656:Slc24a2 UTSW 4 87049907 missense probably damaging 1.00
X0003:Slc24a2 UTSW 4 86991447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGTCATTTCATCAGGCAAG -3'
(R):5'- TGACTGTCAGCAGCAATGGC -3'

Sequencing Primer
(F):5'- CCTGTGAAGTGAATGTCCCCATG -3'
(R):5'- AGCAGCAATGGCCTCTTCTG -3'
Posted On 2014-12-29