Mutagenetix > Incidental Mutation

Incidental Mutation 'R2922:Atp6v0a2'

255569

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

040507-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R2922 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 124717917 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 656 (T656M)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037865
AA Change: T656M

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: T656M

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197087

Predicted Effect

probably benign
Transcript: ENSMUST00000197161

SMART Domains

Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199526

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199971

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,861,534	D90G	possibly damaging	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Bsn	C	T	9: 108,108,186	V2890M	unknown	Het
Bsn	T	C	9: 108,115,469	E1028G	probably damaging	Het
Ccdc116	T	C	16: 17,142,443	H170R	probably benign	Het
Cdk11b	CAGAAGAAG	CAGAAG	4: 155,640,744		probably benign	Het
Clpb	A	G	7: 101,722,828	D257G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Dlgap5	A	G	14: 47,390,441		probably null	Het
Dmwd	T	C	7: 19,076,345	F26L	probably damaging	Het
Eif5b	T	C	1: 38,018,019		probably benign	Het
Flii	A	G	11: 60,718,916	Y622H	probably damaging	Het
Gbp7	A	T	3: 142,534,572	E17V	probably benign	Het
Ghrh	T	C	2: 157,331,877		probably null	Het
Gm20939	T	A	17: 94,877,293	H456Q	probably damaging	Het
Golga4	T	A	9: 118,559,343	S1844R	possibly damaging	Het
Hgd	T	C	16: 37,618,968	F213L	probably damaging	Het
Hoxb1	T	C	11: 96,366,293	L156P	probably benign	Het
Itga11	A	G	9: 62,768,630		probably benign	Het
Kcnn3	T	C	3: 89,521,022	V185A	probably damaging	Het
Lrriq1	T	C	10: 103,214,675	T739A	probably benign	Het
Mib1	C	T	18: 10,760,831	Q374*	probably null	Het
Myh9	A	G	15: 77,813,184	L10P	probably damaging	Het
Ncor2	A	G	5: 125,055,791	F44S	probably damaging	Het
Nr3c1	C	A	18: 39,487,103	A44S	possibly damaging	Het
Olfr148	G	A	9: 39,613,764	V66I	probably benign	Het
Olfr644	A	G	7: 104,068,587	V148A	probably benign	Het
Ovch2	A	G	7: 107,790,389	L317P	possibly damaging	Het
Pcolce2	T	A	9: 95,694,714	L346Q	probably damaging	Het
Rdm1	T	A	11: 101,630,890	L157H	possibly damaging	Het
Rptn	A	G	3: 93,398,708	Y1116C	possibly damaging	Het
Scn7a	A	G	2: 66,700,207		probably benign	Het
Slc24a2	A	G	4: 86,991,354	V660A	possibly damaging	Het
Tet3	A	G	6: 83,368,512	S1648P	probably damaging	Het
Tmem198b	G	A	10: 128,802,193	T167I	probably damaging	Het
Tmem2	A	G	19: 21,817,939	D732G	possibly damaging	Het
Tmx1	T	A	12: 70,466,121	C268S	probably benign	Het
Ubr4	A	G	4: 139,479,500	N4886S	possibly damaging	Het
Usp47	A	G	7: 112,093,198	S956G	probably damaging	Het
Vmn2r60	T	A	7: 42,141,035	V482E	probably damaging	Het
Zfhx4	C	T	3: 5,403,664	P2986S	probably damaging	Het
Zfp507	T	C	7: 35,794,799	E273G	probably damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTGAATGCTATGAGTCAGAAG -3'
(R):5'- ACTGTCTCAGAGCAATGGGG -3'

Sequencing Primer
(F):5'- TGCTATGAGTCAGAAGAAGTGTG -3'
(R):5'- ACAGAACTGCGCTGTGACTC -3'

Posted On

2014-12-29