Incidental Mutation 'R0319:Vmn2r61'
ID25557
Institutional Source Beutler Lab
Gene Symbol Vmn2r61
Ensembl Gene ENSMUSG00000090967
Gene Namevomeronasal 2, receptor 61
SynonymsEG637873, Casr-rs2, Gprc2a-rs2
MMRRC Submission 038529-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0319 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42260053-42300755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42300517 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 787 (M787K)
Ref Sequence ENSEMBL: ENSMUSP00000129576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166131]
Predicted Effect probably damaging
Transcript: ENSMUST00000166131
AA Change: M787K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: M787K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 4e-42 PFAM
Pfam:NCD3G 514 567 1.9e-21 PFAM
Pfam:7tm_3 600 835 6.2e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173044
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Actg2 T A 6: 83,520,743 I103F probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Arhgef19 A T 4: 141,256,399 T748S possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Atxn10 T C 15: 85,365,282 L105P probably damaging Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kcnv2 A T 19: 27,324,024 Y425F probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Malt1 T C 18: 65,462,915 probably null Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ttll9 C A 2: 153,000,098 probably null Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Xdh T A 17: 73,906,101 probably benign Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Vmn2r61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r61 APN 7 42300751 missense possibly damaging 0.96
IGL00824:Vmn2r61 APN 7 42267014 missense probably benign 0.03
IGL00903:Vmn2r61 APN 7 42300511 missense probably damaging 1.00
IGL01125:Vmn2r61 APN 7 42260126 missense probably damaging 1.00
IGL01393:Vmn2r61 APN 7 42266834 missense probably benign 0.08
IGL01712:Vmn2r61 APN 7 42260237 missense probably damaging 0.98
IGL01822:Vmn2r61 APN 7 42300706 missense probably benign 0.18
IGL01835:Vmn2r61 APN 7 42300591 missense probably benign 0.12
IGL01844:Vmn2r61 APN 7 42260215 missense probably benign 0.00
IGL01953:Vmn2r61 APN 7 42300189 missense probably damaging 1.00
IGL02032:Vmn2r61 APN 7 42300042 missense probably damaging 0.99
IGL02054:Vmn2r61 APN 7 42276734 critical splice donor site probably null
IGL02569:Vmn2r61 APN 7 42276646 missense probably damaging 1.00
IGL02697:Vmn2r61 APN 7 42275468 missense possibly damaging 0.55
IGL02958:Vmn2r61 APN 7 42299937 missense probably benign
IGL03290:Vmn2r61 APN 7 42265984 missense probably benign 0.00
IGL03337:Vmn2r61 APN 7 42267085 missense possibly damaging 0.58
IGL03369:Vmn2r61 APN 7 42260093 missense probably benign
IGL03402:Vmn2r61 APN 7 42260255 missense probably benign
R0026:Vmn2r61 UTSW 7 42275474 missense possibly damaging 0.64
R0433:Vmn2r61 UTSW 7 42265911 missense probably benign 0.02
R0555:Vmn2r61 UTSW 7 42266018 missense probably benign 0.02
R0691:Vmn2r61 UTSW 7 42300420 missense probably damaging 1.00
R1701:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R1718:Vmn2r61 UTSW 7 42300697 missense probably benign
R1835:Vmn2r61 UTSW 7 42266652 nonsense probably null
R1920:Vmn2r61 UTSW 7 42300286 missense possibly damaging 0.73
R2069:Vmn2r61 UTSW 7 42300001 missense probably benign 0.06
R2326:Vmn2r61 UTSW 7 42266863 missense probably damaging 1.00
R2402:Vmn2r61 UTSW 7 42300105 missense possibly damaging 0.90
R3103:Vmn2r61 UTSW 7 42266643 missense possibly damaging 0.73
R3107:Vmn2r61 UTSW 7 42267067 missense possibly damaging 0.82
R4426:Vmn2r61 UTSW 7 42300733 missense probably benign
R4426:Vmn2r61 UTSW 7 42300735 missense probably benign
R4484:Vmn2r61 UTSW 7 42300696 missense probably benign
R4748:Vmn2r61 UTSW 7 42267141 missense probably damaging 0.96
R4835:Vmn2r61 UTSW 7 42267035 missense possibly damaging 0.52
R4863:Vmn2r61 UTSW 7 42300708 missense probably benign 0.03
R4923:Vmn2r61 UTSW 7 42267096 missense probably damaging 1.00
R4968:Vmn2r61 UTSW 7 42300054 missense probably benign 0.14
R5114:Vmn2r61 UTSW 7 42300529 missense possibly damaging 0.92
R5297:Vmn2r61 UTSW 7 42260222 missense probably benign
R5497:Vmn2r61 UTSW 7 42275482 missense possibly damaging 0.95
R5508:Vmn2r61 UTSW 7 42266818 missense possibly damaging 0.52
R5587:Vmn2r61 UTSW 7 42300487 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42300493 missense probably damaging 1.00
R5615:Vmn2r61 UTSW 7 42267253 missense probably benign 0.00
R5782:Vmn2r61 UTSW 7 42299829 missense probably damaging 1.00
R6136:Vmn2r61 UTSW 7 42267031 missense probably damaging 1.00
R6207:Vmn2r61 UTSW 7 42260192 missense probably benign 0.01
R6265:Vmn2r61 UTSW 7 42266491 missense probably benign 0.01
R6272:Vmn2r61 UTSW 7 42299818 missense probably damaging 1.00
R6355:Vmn2r61 UTSW 7 42267235 missense probably benign 0.00
R6469:Vmn2r61 UTSW 7 42265859 nonsense probably null
R6554:Vmn2r61 UTSW 7 42276715 missense probably damaging 1.00
R6699:Vmn2r61 UTSW 7 42300156 missense probably benign
R6768:Vmn2r61 UTSW 7 42300324 missense probably damaging 1.00
R6824:Vmn2r61 UTSW 7 42299979 missense probably benign 0.10
R6930:Vmn2r61 UTSW 7 42299940 missense probably benign 0.02
R7053:Vmn2r61 UTSW 7 42267133 missense probably damaging 0.96
R7238:Vmn2r61 UTSW 7 42267205 missense possibly damaging 0.73
R7332:Vmn2r61 UTSW 7 42260110 missense probably benign 0.00
R7359:Vmn2r61 UTSW 7 42265983 missense probably benign 0.11
R7553:Vmn2r61 UTSW 7 42266781 missense not run
R7710:Vmn2r61 UTSW 7 42267048 missense probably damaging 1.00
R7732:Vmn2r61 UTSW 7 42266673 missense probably benign
R7839:Vmn2r61 UTSW 7 42266608 missense probably damaging 0.97
R7916:Vmn2r61 UTSW 7 42300511 missense probably damaging 1.00
R8026:Vmn2r61 UTSW 7 42266717 missense probably benign 0.02
Z1088:Vmn2r61 UTSW 7 42299964 missense possibly damaging 0.93
Z1176:Vmn2r61 UTSW 7 42260161 missense possibly damaging 0.46
Z1176:Vmn2r61 UTSW 7 42266742 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTGAACATGGTCACATCATC -3'
(R):5'- TGCTGACACATCTTCCACAGGAAC -3'

Sequencing Primer
(F):5'- CTACACCATGGCCTTCTTGT -3'
(R):5'- TTATGGGACACTAGGCCAAC -3'
Posted On2013-04-16