Mutagenetix > Incidental Mutation

Incidental Mutation 'R2922:Tet3'

255571

Institutional Source

Beutler Lab

Gene Symbol

Tet3

Ensembl Gene

ENSMUSG00000034832

Gene Name

tet methylcytosine dioxygenase 3

Synonyms

D230004J03Rik, B430006D22Rik

MMRRC Submission

040507-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.641) question?

Stock #

R2922 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83362373-83459084 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83368512 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1648 (S1648P)

Ref Sequence

ENSEMBL: ENSMUSP00000139630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548]

AlphaFold

Q8BG87

Predicted Effect

probably damaging
Transcript: ENSMUST00000089622
AA Change: S1513P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: S1513P

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
low complexity region	66	77	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
internal_repeat_1	160	277	4.9e-5	PROSPERO
low complexity region	279	297	N/A	INTRINSIC
low complexity region	359	371	N/A	INTRINSIC
low complexity region	418	456	N/A	INTRINSIC
Tet_JBP	858	1570	N/A	SMART
coiled coil region	1579	1603	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186548
AA Change: S1648P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: S1648P

Domain	Start	End	E-Value	Type
Pfam:zf-CXXC	49	89	8e-6	PFAM
low complexity region	162	173	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	250	261	N/A	INTRINSIC
internal_repeat_1	295	412	5.5e-5	PROSPERO
low complexity region	414	432	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
low complexity region	553	591	N/A	INTRINSIC
Tet_JBP	993	1705	N/A	SMART
coiled coil region	1714	1738	N/A	INTRINSIC

Meta Mutation Damage Score

0.3360

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,861,534	D90G	possibly damaging	Het
Atp6v0a2	C	T	5: 124,717,917	T656M	possibly damaging	Het
Baz2a	AGCGGCGGTACTTGCGGG	AG	10: 128,125,077		probably null	Het
Bsn	C	T	9: 108,108,186	V2890M	unknown	Het
Bsn	T	C	9: 108,115,469	E1028G	probably damaging	Het
Ccdc116	T	C	16: 17,142,443	H170R	probably benign	Het
Cdk11b	CAGAAGAAG	CAGAAG	4: 155,640,744		probably benign	Het
Clpb	A	G	7: 101,722,828	D257G	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Dlgap5	A	G	14: 47,390,441		probably null	Het
Dmwd	T	C	7: 19,076,345	F26L	probably damaging	Het
Eif5b	T	C	1: 38,018,019		probably benign	Het
Flii	A	G	11: 60,718,916	Y622H	probably damaging	Het
Gbp7	A	T	3: 142,534,572	E17V	probably benign	Het
Ghrh	T	C	2: 157,331,877		probably null	Het
Gm20939	T	A	17: 94,877,293	H456Q	probably damaging	Het
Golga4	T	A	9: 118,559,343	S1844R	possibly damaging	Het
Hgd	T	C	16: 37,618,968	F213L	probably damaging	Het
Hoxb1	T	C	11: 96,366,293	L156P	probably benign	Het
Itga11	A	G	9: 62,768,630		probably benign	Het
Kcnn3	T	C	3: 89,521,022	V185A	probably damaging	Het
Lrriq1	T	C	10: 103,214,675	T739A	probably benign	Het
Mib1	C	T	18: 10,760,831	Q374*	probably null	Het
Myh9	A	G	15: 77,813,184	L10P	probably damaging	Het
Ncor2	A	G	5: 125,055,791	F44S	probably damaging	Het
Nr3c1	C	A	18: 39,487,103	A44S	possibly damaging	Het
Olfr148	G	A	9: 39,613,764	V66I	probably benign	Het
Olfr644	A	G	7: 104,068,587	V148A	probably benign	Het
Ovch2	A	G	7: 107,790,389	L317P	possibly damaging	Het
Pcolce2	T	A	9: 95,694,714	L346Q	probably damaging	Het
Rdm1	T	A	11: 101,630,890	L157H	possibly damaging	Het
Rptn	A	G	3: 93,398,708	Y1116C	possibly damaging	Het
Scn7a	A	G	2: 66,700,207		probably benign	Het
Slc24a2	A	G	4: 86,991,354	V660A	possibly damaging	Het
Tmem198b	G	A	10: 128,802,193	T167I	probably damaging	Het
Tmem2	A	G	19: 21,817,939	D732G	possibly damaging	Het
Tmx1	T	A	12: 70,466,121	C268S	probably benign	Het
Ubr4	A	G	4: 139,479,500	N4886S	possibly damaging	Het
Usp47	A	G	7: 112,093,198	S956G	probably damaging	Het
Vmn2r60	T	A	7: 42,141,035	V482E	probably damaging	Het
Zfhx4	C	T	3: 5,403,664	P2986S	probably damaging	Het
Zfp507	T	C	7: 35,794,799	E273G	probably damaging	Het

Other mutations in Tet3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Tet3	APN	6	83368655	missense	probably benign	0.06
IGL01396:Tet3	APN	6	83369638	nonsense	probably null
IGL02344:Tet3	APN	6	83403833	missense	probably benign	0.04
IGL02987:Tet3	APN	6	83368092	missense	probably damaging	0.99
IGL03126:Tet3	APN	6	83376787	missense	probably damaging	1.00
IGL03155:Tet3	APN	6	83368383	missense	probably damaging	1.00
IGL03286:Tet3	APN	6	83375778	missense	probably damaging	1.00
Reedy	UTSW	6	83368084	nonsense	probably null
P0033:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R0131:Tet3	UTSW	6	83368788	missense	probably damaging	1.00
R0295:Tet3	UTSW	6	83369139	missense	probably benign	0.14
R0504:Tet3	UTSW	6	83373794	missense	probably damaging	1.00
R0524:Tet3	UTSW	6	83379942	missense	probably damaging	1.00
R1061:Tet3	UTSW	6	83373323	missense	probably damaging	0.99
R1160:Tet3	UTSW	6	83404452	missense	probably benign	0.00
R1550:Tet3	UTSW	6	83386028	missense	probably damaging	0.97
R1640:Tet3	UTSW	6	83369315	missense	probably benign	0.44
R1658:Tet3	UTSW	6	83369057	missense	probably benign	0.44
R1746:Tet3	UTSW	6	83368068	missense	probably damaging	1.00
R1761:Tet3	UTSW	6	83403659	missense	probably damaging	0.99
R1832:Tet3	UTSW	6	83403645	missense	probably benign
R1835:Tet3	UTSW	6	83404163	missense	possibly damaging	0.95
R1932:Tet3	UTSW	6	83404379	missense	possibly damaging	0.94
R2014:Tet3	UTSW	6	83386075	missense	probably damaging	1.00
R2230:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2232:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R3429:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R3430:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R4291:Tet3	UTSW	6	83373199	missense	probably damaging	1.00
R4349:Tet3	UTSW	6	83403275	missense	probably benign
R4809:Tet3	UTSW	6	83402946	missense	probably benign
R4846:Tet3	UTSW	6	83376883	nonsense	probably null
R5039:Tet3	UTSW	6	83375896	missense	probably damaging	1.00
R5233:Tet3	UTSW	6	83386063	missense	probably damaging	1.00
R5363:Tet3	UTSW	6	83376764	critical splice donor site	probably null
R5880:Tet3	UTSW	6	83370550	missense	probably damaging	1.00
R6270:Tet3	UTSW	6	83375791	missense	possibly damaging	0.86
R6277:Tet3	UTSW	6	83368084	nonsense	probably null
R6564:Tet3	UTSW	6	83386070	missense	possibly damaging	0.92
R6622:Tet3	UTSW	6	83403444	missense	probably benign	0.00
R7089:Tet3	UTSW	6	83455024	missense	possibly damaging	0.46
R7244:Tet3	UTSW	6	83370621	missense	probably damaging	1.00
R7251:Tet3	UTSW	6	83404056	missense	probably benign
R7361:Tet3	UTSW	6	83368094	missense	probably benign	0.15
R7436:Tet3	UTSW	6	83368229	small insertion	probably benign
R7438:Tet3	UTSW	6	83368229	small insertion	probably benign
R7544:Tet3	UTSW	6	83404641	missense	probably damaging	1.00
R7552:Tet3	UTSW	6	83368307	missense	probably damaging	1.00
R7942:Tet3	UTSW	6	83376974	missense	probably damaging	1.00
R8010:Tet3	UTSW	6	83403246	missense	unknown
R8063:Tet3	UTSW	6	83402741	missense	probably damaging	1.00
R8307:Tet3	UTSW	6	83379927	missense	probably damaging	1.00
R9016:Tet3	UTSW	6	83368271	missense	probably damaging	1.00
R9020:Tet3	UTSW	6	83404436	missense	probably damaging	1.00
R9377:Tet3	UTSW	6	83403614	missense	possibly damaging	0.95
R9476:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9476:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9510:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9510:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9582:Tet3	UTSW	6	83404244	missense	probably damaging	0.99
R9671:Tet3	UTSW	6	83404154	missense	possibly damaging	0.89
R9801:Tet3	UTSW	6	83369454	missense	possibly damaging	0.94
X0004:Tet3	UTSW	6	83403423	missense	probably benign	0.17
Z1176:Tet3	UTSW	6	83370698	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83404350	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83459021	missense	unknown
Z1177:Tet3	UTSW	6	83404294	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TTCATCTTGGCCTCCCAGAG -3'
(R):5'- GCTAGACAAAGCCTGGCAAG -3'

Sequencing Primer
(F):5'- TTGAGGTTCTTGTGTTGGTAGAAGAC -3'
(R):5'- AAAGCCTGGCAAGCCTTTG -3'

Posted On

2014-12-29