Incidental Mutation 'R2922:Zfp507'
ID255573
Institutional Source Beutler Lab
Gene Symbol Zfp507
Ensembl Gene ENSMUSG00000044452
Gene Namezinc finger protein 507
Synonyms1810022O10Rik, A230056M16Rik
MMRRC Submission 040507-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R2922 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35772343-35803003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35794799 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 273 (E273G)
Ref Sequence ENSEMBL: ENSMUSP00000058609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061586] [ENSMUST00000187282] [ENSMUST00000205670] [ENSMUST00000206615]
Predicted Effect probably damaging
Transcript: ENSMUST00000061586
AA Change: E273G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058609
Gene: ENSMUSG00000044452
AA Change: E273G

DomainStartEndE-ValueType
ZnF_C2H2 122 144 1.56e-2 SMART
ZnF_C2H2 152 175 2.49e-1 SMART
low complexity region 178 192 N/A INTRINSIC
ZnF_C2H2 237 259 8.52e0 SMART
ZnF_C2H2 630 652 2.75e-3 SMART
ZnF_C2H2 658 680 1.26e-2 SMART
ZnF_C2H2 686 709 5.42e-2 SMART
ZnF_C2H2 746 768 4.79e-3 SMART
ZnF_C2H2 774 796 1.45e-2 SMART
ZnF_C2H2 899 921 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187282
SMART Domains Protein: ENSMUSP00000140940
Gene: ENSMUSG00000044452

DomainStartEndE-ValueType
ZnF_C2H2 107 129 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205670
Predicted Effect probably benign
Transcript: ENSMUST00000206615
Meta Mutation Damage Score 0.1471 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Other mutations in Zfp507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Zfp507 APN 7 35794712 missense possibly damaging 0.93
IGL00835:Zfp507 APN 7 35776038 missense probably damaging 1.00
IGL01083:Zfp507 APN 7 35794038 missense probably benign 0.00
IGL01359:Zfp507 APN 7 35794502 missense probably damaging 1.00
IGL01418:Zfp507 APN 7 35793812 intron probably null
IGL02122:Zfp507 APN 7 35776095 missense probably damaging 1.00
IGL02506:Zfp507 APN 7 35776466 missense probably damaging 1.00
IGL02601:Zfp507 APN 7 35791711 missense probably damaging 1.00
IGL02643:Zfp507 APN 7 35795231 missense probably damaging 0.99
IGL03129:Zfp507 APN 7 35794206 missense probably damaging 1.00
R0400:Zfp507 UTSW 7 35791746 missense probably damaging 1.00
R0812:Zfp507 UTSW 7 35802623 intron probably benign
R1183:Zfp507 UTSW 7 35794890 missense probably damaging 0.99
R1381:Zfp507 UTSW 7 35776010 missense possibly damaging 0.91
R1542:Zfp507 UTSW 7 35794801 missense possibly damaging 0.71
R1626:Zfp507 UTSW 7 35795433 missense probably damaging 1.00
R1759:Zfp507 UTSW 7 35775978 missense probably damaging 0.99
R1843:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1852:Zfp507 UTSW 7 35787751 missense probably damaging 1.00
R1893:Zfp507 UTSW 7 35802627 intron probably benign
R1923:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1925:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R1927:Zfp507 UTSW 7 35793725 missense probably damaging 0.97
R2139:Zfp507 UTSW 7 35793723 missense probably damaging 1.00
R2191:Zfp507 UTSW 7 35794843 missense probably damaging 1.00
R2431:Zfp507 UTSW 7 35795402 missense probably benign 0.08
R2921:Zfp507 UTSW 7 35794799 missense probably damaging 1.00
R3436:Zfp507 UTSW 7 35787770 missense probably damaging 1.00
R4483:Zfp507 UTSW 7 35787716 critical splice donor site probably null
R4751:Zfp507 UTSW 7 35794382 missense probably damaging 0.99
R4852:Zfp507 UTSW 7 35794055 missense probably benign 0.01
R5298:Zfp507 UTSW 7 35775996 missense probably damaging 0.99
R5602:Zfp507 UTSW 7 35776238 nonsense probably null
R5707:Zfp507 UTSW 7 35794163 missense probably damaging 1.00
R5785:Zfp507 UTSW 7 35787742 missense probably benign 0.20
R6140:Zfp507 UTSW 7 35794188 missense probably damaging 1.00
R6674:Zfp507 UTSW 7 35794734 missense probably damaging 0.98
R6714:Zfp507 UTSW 7 35787727 missense probably damaging 0.99
R7045:Zfp507 UTSW 7 35795553 missense possibly damaging 0.56
R7334:Zfp507 UTSW 7 35776080 missense probably damaging 1.00
R7365:Zfp507 UTSW 7 35776418 missense unknown
R7569:Zfp507 UTSW 7 35794544 missense probably damaging 0.99
R7662:Zfp507 UTSW 7 35787804 nonsense probably null
R7846:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
R7929:Zfp507 UTSW 7 35794538 missense probably damaging 1.00
Z1088:Zfp507 UTSW 7 35794277 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCGTGACTGCCTGGTTTAG -3'
(R):5'- ACATCCCAGTGAACATGGG -3'

Sequencing Primer
(F):5'- AGGTGTACTCCCTCCTCTGTG -3'
(R):5'- ATCCCAGTGAACATGGGCAGTC -3'
Posted On2014-12-29