Incidental Mutation 'R2922:Vmn2r60'
ID 255574
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Name vomeronasal 2, receptor 60
Synonyms Gprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission 040507-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R2922 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 42116471-42195776 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42141035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 482 (V482E)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
AlphaFold A0A3B2WBC8
Predicted Effect probably damaging
Transcript: ENSMUST00000166447
AA Change: V482E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: V482E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
R7526:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7527:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7528:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7764:Vmn2r60 UTSW 7 42195111 missense probably damaging 0.99
R7843:Vmn2r60 UTSW 7 42195087 missense probably benign 0.00
R8080:Vmn2r60 UTSW 7 42141097 missense probably benign 0.30
R8290:Vmn2r60 UTSW 7 42142266 missense probably damaging 1.00
R8342:Vmn2r60 UTSW 7 42141070 missense possibly damaging 0.63
R8362:Vmn2r60 UTSW 7 42195530 missense probably damaging 1.00
R8418:Vmn2r60 UTSW 7 42195426 missense probably damaging 0.97
R8848:Vmn2r60 UTSW 7 42136745 missense probably damaging 1.00
R8860:Vmn2r60 UTSW 7 42142230 missense probably damaging 0.99
R8882:Vmn2r60 UTSW 7 42141094 missense probably benign 0.00
R8913:Vmn2r60 UTSW 7 42136354 missense probably benign 0.27
R9190:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.99
R9229:Vmn2r60 UTSW 7 42142299 missense possibly damaging 0.95
R9295:Vmn2r60 UTSW 7 42136531 missense probably benign 0.01
R9335:Vmn2r60 UTSW 7 42194908 missense probably damaging 1.00
R9796:Vmn2r60 UTSW 7 42135748 missense probably benign
RF024:Vmn2r60 UTSW 7 42140939 missense probably benign 0.01
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTGGACATGGCTGTTTCAAATGAG -3'
(R):5'- GAGTTTAATGGTCATGACATCCTG -3'

Sequencing Primer
(F):5'- ATGGCTGTTTCAAATGAGATTCTTTG -3'
(R):5'- GGTCATGACATCCTGAGAATTACC -3'
Posted On 2014-12-29