Incidental Mutation 'R2922:Ovch2'
ID255577
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Nameovochymase 2
Synonyms
MMRRC Submission 040507-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2922 (G1)
Quality Score217
Status Validated
Chromosome7
Chromosomal Location107781544-107801208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107790389 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 317 (L317P)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106755
AA Change: L317P

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: L317P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208448
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1329:Ovch2 UTSW 7 107785446 missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107796568 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107793994 missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107789094 missense probably benign 0.17
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107794370 missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107789088 critical splice donor site probably null
R7841:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7908:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107794000 missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107790377 missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107793255 missense probably damaging 1.00
R8812:Ovch2 UTSW 7 107794044 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGAAAGTGTAACTTCTAGCCAG -3'
(R):5'- TCTCGAGGATAAGCACAGCC -3'

Sequencing Primer
(F):5'- TTCTAGCCAGAAAGTGACAGTC -3'
(R):5'- CTATGAAGCATTATAGAAGCCAAGAC -3'
Posted On2014-12-29