Incidental Mutation 'R2922:Usp47'
ID 255578
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Name ubiquitin specific peptidase 47
Synonyms A630020C16Rik, 4930502N04Rik
MMRRC Submission 040507-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.839) question?
Stock # R2922 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 111622692-111710591 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111692405 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 956 (S956G)
Ref Sequence ENSEMBL: ENSMUSP00000147619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
AlphaFold Q8BY87
Predicted Effect probably damaging
Transcript: ENSMUST00000106653
AA Change: S936G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: S936G

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210309
AA Change: S956G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210526
Predicted Effect probably damaging
Transcript: ENSMUST00000215510
AA Change: S956G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.1662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,393 (GRCm39) D90G possibly damaging Het
Atp6v0a2 C T 5: 124,794,981 (GRCm39) T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Bsn C T 9: 107,985,385 (GRCm39) V2890M unknown Het
Bsn T C 9: 107,992,668 (GRCm39) E1028G probably damaging Het
Ccdc116 T C 16: 16,960,307 (GRCm39) H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,725,201 (GRCm39) probably benign Het
Cemip2 A G 19: 21,795,303 (GRCm39) D732G possibly damaging Het
Clpb A G 7: 101,372,035 (GRCm39) D257G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Dlgap5 A G 14: 47,627,898 (GRCm39) probably null Het
Dmwd T C 7: 18,810,270 (GRCm39) F26L probably damaging Het
Eif5b T C 1: 38,057,100 (GRCm39) probably benign Het
Flii A G 11: 60,609,742 (GRCm39) Y622H probably damaging Het
Gbp7 A T 3: 142,240,333 (GRCm39) E17V probably benign Het
Ghrh T C 2: 157,173,797 (GRCm39) probably null Het
Gm20939 T A 17: 95,184,721 (GRCm39) H456Q probably damaging Het
Golga4 T A 9: 118,388,411 (GRCm39) S1844R possibly damaging Het
Hgd T C 16: 37,439,330 (GRCm39) F213L probably damaging Het
Hoxb1 T C 11: 96,257,119 (GRCm39) L156P probably benign Het
Itga11 A G 9: 62,675,912 (GRCm39) probably benign Het
Kcnn3 T C 3: 89,428,329 (GRCm39) V185A probably damaging Het
Lrriq1 T C 10: 103,050,536 (GRCm39) T739A probably benign Het
Mib1 C T 18: 10,760,831 (GRCm39) Q374* probably null Het
Myh9 A G 15: 77,697,384 (GRCm39) L10P probably damaging Het
Ncor2 A G 5: 125,132,855 (GRCm39) F44S probably damaging Het
Nr3c1 C A 18: 39,620,156 (GRCm39) A44S possibly damaging Het
Or10n1 G A 9: 39,525,060 (GRCm39) V66I probably benign Het
Or51a43 A G 7: 103,717,794 (GRCm39) V148A probably benign Het
Ovch2 A G 7: 107,389,596 (GRCm39) L317P possibly damaging Het
Pcolce2 T A 9: 95,576,767 (GRCm39) L346Q probably damaging Het
Rdm1 T A 11: 101,521,716 (GRCm39) L157H possibly damaging Het
Rptn A G 3: 93,306,015 (GRCm39) Y1116C possibly damaging Het
Scn7a A G 2: 66,530,551 (GRCm39) probably benign Het
Slc24a2 A G 4: 86,909,591 (GRCm39) V660A possibly damaging Het
Tet3 A G 6: 83,345,494 (GRCm39) S1648P probably damaging Het
Tmem198b G A 10: 128,638,062 (GRCm39) T167I probably damaging Het
Tmx1 T A 12: 70,512,895 (GRCm39) C268S probably benign Het
Ubr4 A G 4: 139,206,811 (GRCm39) N4886S possibly damaging Het
Vmn2r60 T A 7: 41,790,459 (GRCm39) V482E probably damaging Het
Zfhx4 C T 3: 5,468,724 (GRCm39) P2986S probably damaging Het
Zfp507 T C 7: 35,494,224 (GRCm39) E273G probably damaging Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 111,673,990 (GRCm39) missense probably benign 0.00
IGL00574:Usp47 APN 7 111,662,542 (GRCm39) missense probably damaging 1.00
IGL00975:Usp47 APN 7 111,692,577 (GRCm39) missense probably damaging 1.00
IGL01289:Usp47 APN 7 111,662,565 (GRCm39) missense probably damaging 1.00
IGL01419:Usp47 APN 7 111,687,118 (GRCm39) missense possibly damaging 0.94
IGL01645:Usp47 APN 7 111,654,069 (GRCm39) missense probably damaging 0.96
IGL01871:Usp47 APN 7 111,676,993 (GRCm39) splice site probably benign
IGL02066:Usp47 APN 7 111,663,604 (GRCm39) missense probably damaging 1.00
IGL02122:Usp47 APN 7 111,706,115 (GRCm39) missense probably damaging 0.97
IGL02153:Usp47 APN 7 111,703,256 (GRCm39) missense probably benign 0.00
IGL02550:Usp47 APN 7 111,703,561 (GRCm39) missense probably damaging 1.00
IGL02710:Usp47 APN 7 111,692,132 (GRCm39) missense probably benign 0.01
IGL02756:Usp47 APN 7 111,692,270 (GRCm39) missense possibly damaging 0.76
IGL03093:Usp47 APN 7 111,688,827 (GRCm39) missense probably damaging 1.00
IGL03398:Usp47 APN 7 111,673,710 (GRCm39) missense probably damaging 1.00
0152:Usp47 UTSW 7 111,655,784 (GRCm39) missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 111,703,548 (GRCm39) splice site probably benign
R0110:Usp47 UTSW 7 111,655,787 (GRCm39) missense possibly damaging 0.88
R0381:Usp47 UTSW 7 111,662,600 (GRCm39) critical splice donor site probably null
R0450:Usp47 UTSW 7 111,655,787 (GRCm39) missense possibly damaging 0.88
R0634:Usp47 UTSW 7 111,707,862 (GRCm39) missense probably damaging 1.00
R0881:Usp47 UTSW 7 111,690,643 (GRCm39) missense possibly damaging 0.51
R1178:Usp47 UTSW 7 111,709,205 (GRCm39) missense possibly damaging 0.68
R1447:Usp47 UTSW 7 111,673,775 (GRCm39) critical splice donor site probably null
R1640:Usp47 UTSW 7 111,682,334 (GRCm39) missense probably damaging 0.99
R1727:Usp47 UTSW 7 111,685,307 (GRCm39) missense probably damaging 0.96
R1866:Usp47 UTSW 7 111,701,077 (GRCm39) missense possibly damaging 0.93
R1876:Usp47 UTSW 7 111,654,127 (GRCm39) missense probably damaging 0.99
R1953:Usp47 UTSW 7 111,692,083 (GRCm39) missense probably benign 0.26
R2117:Usp47 UTSW 7 111,666,443 (GRCm39) critical splice donor site probably null
R2176:Usp47 UTSW 7 111,691,934 (GRCm39) missense probably benign 0.00
R2187:Usp47 UTSW 7 111,666,398 (GRCm39) missense probably damaging 1.00
R2504:Usp47 UTSW 7 111,703,677 (GRCm39) critical splice donor site probably null
R2902:Usp47 UTSW 7 111,692,658 (GRCm39) missense probably damaging 1.00
R2939:Usp47 UTSW 7 111,681,743 (GRCm39) missense probably damaging 1.00
R4065:Usp47 UTSW 7 111,652,623 (GRCm39) missense probably benign 0.30
R4179:Usp47 UTSW 7 111,687,091 (GRCm39) missense probably damaging 1.00
R4235:Usp47 UTSW 7 111,709,255 (GRCm39) missense probably damaging 0.99
R4243:Usp47 UTSW 7 111,707,836 (GRCm39) missense probably damaging 1.00
R4281:Usp47 UTSW 7 111,709,200 (GRCm39) missense probably benign 0.03
R4360:Usp47 UTSW 7 111,654,139 (GRCm39) missense probably damaging 1.00
R4604:Usp47 UTSW 7 111,701,038 (GRCm39) missense probably damaging 1.00
R4857:Usp47 UTSW 7 111,681,759 (GRCm39) missense probably damaging 1.00
R5133:Usp47 UTSW 7 111,683,089 (GRCm39) missense probably damaging 1.00
R5179:Usp47 UTSW 7 111,692,639 (GRCm39) missense probably damaging 1.00
R5322:Usp47 UTSW 7 111,652,476 (GRCm39) missense probably damaging 0.99
R5445:Usp47 UTSW 7 111,673,928 (GRCm39) missense probably damaging 1.00
R5465:Usp47 UTSW 7 111,658,209 (GRCm39) missense probably damaging 1.00
R5699:Usp47 UTSW 7 111,709,204 (GRCm39) missense probably benign 0.00
R5961:Usp47 UTSW 7 111,652,523 (GRCm39) missense probably damaging 1.00
R6117:Usp47 UTSW 7 111,687,139 (GRCm39) missense probably damaging 0.98
R6271:Usp47 UTSW 7 111,686,263 (GRCm39) missense probably damaging 1.00
R7155:Usp47 UTSW 7 111,686,220 (GRCm39) missense probably damaging 0.97
R7229:Usp47 UTSW 7 111,692,084 (GRCm39) missense probably benign 0.04
R7246:Usp47 UTSW 7 111,715,116 (GRCm39)
R7285:Usp47 UTSW 7 111,692,315 (GRCm39) missense probably benign 0.02
R7938:Usp47 UTSW 7 111,687,132 (GRCm39) missense probably damaging 0.99
R8079:Usp47 UTSW 7 111,646,177 (GRCm39) missense probably damaging 1.00
R8114:Usp47 UTSW 7 111,692,394 (GRCm39) missense probably damaging 1.00
R8141:Usp47 UTSW 7 111,652,472 (GRCm39) missense possibly damaging 0.60
R8172:Usp47 UTSW 7 111,687,133 (GRCm39) nonsense probably null
R8223:Usp47 UTSW 7 111,703,583 (GRCm39) missense probably damaging 1.00
R8510:Usp47 UTSW 7 111,658,208 (GRCm39) missense probably damaging 1.00
R8701:Usp47 UTSW 7 111,692,402 (GRCm39) missense probably damaging 1.00
R9106:Usp47 UTSW 7 111,681,713 (GRCm39) missense probably damaging 1.00
R9135:Usp47 UTSW 7 111,652,431 (GRCm39) missense probably benign 0.30
R9311:Usp47 UTSW 7 111,703,257 (GRCm39) missense probably benign 0.02
R9417:Usp47 UTSW 7 111,688,801 (GRCm39) missense possibly damaging 0.86
R9487:Usp47 UTSW 7 111,677,063 (GRCm39) missense probably damaging 0.99
R9628:Usp47 UTSW 7 111,705,999 (GRCm39) missense probably benign 0.01
RF010:Usp47 UTSW 7 111,692,145 (GRCm39) missense probably damaging 0.99
X0027:Usp47 UTSW 7 111,687,054 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAAAGCTTGTCACTGCAG -3'
(R):5'- TTCTTCAGCTGTGTCCCAGG -3'

Sequencing Primer
(F):5'- CAGCAGCAGCAGCAAGATG -3'
(R):5'- GCTGTGTCCCAGGTCTCC -3'
Posted On 2014-12-29