Incidental Mutation 'R0318:Chaf1a'
ID25558
Institutional Source Beutler Lab
Gene Symbol Chaf1a
Ensembl Gene ENSMUSG00000002835
Gene Namechromatin assembly factor 1, subunit A (p150)
SynonymsCAF-1
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0318 (G1)
Quality Score199
Status Not validated
Chromosome17
Chromosomal Location56040416-56068026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56062227 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 486 (T486I)
Ref Sequence ENSEMBL: ENSMUSP00000002914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002914] [ENSMUST00000019722]
PDB Structure
HP1 chromo shadow domain in complex with PXVXL motif of CAF-1 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002914
AA Change: T486I

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002914
Gene: ENSMUSG00000002835
AA Change: T486I

DomainStartEndE-ValueType
Pfam:CAF1-p150_N 1 210 3.8e-59 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:CAF-1_p150 299 458 1e-49 PFAM
low complexity region 466 481 N/A INTRINSIC
Pfam:CAF1A 537 611 1.1e-25 PFAM
Pfam:CAF1-p150_C2 644 908 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019722
SMART Domains Protein: ENSMUSP00000019722
Gene: ENSMUSG00000019578

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Pfam:PUB 168 255 1.6e-27 PFAM
UBX 329 410 1.03e-2 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF1) is a nuclear complex consisting of p50, p60 (CHAF1B; MIM 601245), and p150 (CHAF1A) subunits that assembles histone octamers onto replicating DNA in vitro (Kaufman et al., 1995 [PubMed 7600578]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation in this gene display lethality before implantation, embryonic growth arrest, and abnormal heterochromatin morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Chaf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Chaf1a APN 17 56063336 missense possibly damaging 0.75
IGL01318:Chaf1a APN 17 56059336 splice site probably benign
IGL01344:Chaf1a APN 17 56064104 missense probably damaging 1.00
IGL02740:Chaf1a APN 17 56067500 missense probably damaging 1.00
IGL03328:Chaf1a APN 17 56063374 missense probably damaging 1.00
R0077:Chaf1a UTSW 17 56047384 missense unknown
R0945:Chaf1a UTSW 17 56067441 missense probably damaging 1.00
R1370:Chaf1a UTSW 17 56064032 missense probably benign 0.31
R1520:Chaf1a UTSW 17 56047302 missense unknown
R1641:Chaf1a UTSW 17 56047380 missense unknown
R1669:Chaf1a UTSW 17 56063339 missense probably benign 0.45
R1955:Chaf1a UTSW 17 56047540 missense unknown
R2139:Chaf1a UTSW 17 56065226 missense probably damaging 1.00
R2879:Chaf1a UTSW 17 56044114 critical splice donor site probably null
R4258:Chaf1a UTSW 17 56056474 missense unknown
R4303:Chaf1a UTSW 17 56044068 missense unknown
R4577:Chaf1a UTSW 17 56065184 missense probably damaging 1.00
R5254:Chaf1a UTSW 17 56062606 missense probably benign 0.19
R5260:Chaf1a UTSW 17 56065000 missense probably damaging 1.00
R5976:Chaf1a UTSW 17 56064115 missense probably damaging 1.00
R6746:Chaf1a UTSW 17 56063404 missense possibly damaging 0.77
R6799:Chaf1a UTSW 17 56047059 missense unknown
R7327:Chaf1a UTSW 17 56062573 missense probably benign 0.00
R7445:Chaf1a UTSW 17 56062170 missense possibly damaging 0.85
R7565:Chaf1a UTSW 17 56064148 missense probably benign 0.00
R7782:Chaf1a UTSW 17 56062291 missense probably benign 0.02
R7864:Chaf1a UTSW 17 56047339 missense unknown
R7947:Chaf1a UTSW 17 56047339 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTGAAGGTAGCTCTCAAGTGGC -3'
(R):5'- GGGAAATGGTGACTGTTGGACTCAG -3'

Sequencing Primer
(F):5'- AGTGGCTTTGTTTGAAATCCATCC -3'
(R):5'- TGTTGGACTCAGCAGCATAG -3'
Posted On2013-04-16