Incidental Mutation 'R2922:Pcolce2'
ID255580
Institutional Source Beutler Lab
Gene Symbol Pcolce2
Ensembl Gene ENSMUSG00000015354
Gene Nameprocollagen C-endopeptidase enhancer 2
Synonyms2400001O18Rik, Pcpe2
MMRRC Submission 040507-MU
Accession Numbers

Ncbi RefSeq: NM_029620.2; MGI:1923727

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2922 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95637601-95698096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95694714 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 346 (L346Q)
Ref Sequence ENSEMBL: ENSMUSP00000015498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015498]
Predicted Effect probably damaging
Transcript: ENSMUST00000015498
AA Change: L346Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015498
Gene: ENSMUSG00000015354
AA Change: L346Q

DomainStartEndE-ValueType
CUB 32 143 1.49e-41 SMART
CUB 153 267 2e-42 SMART
low complexity region 268 293 N/A INTRINSIC
C345C 307 412 4.1e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151210
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype Strain: 3722112
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable abnormalities in thymus or T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Pcolce2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pcolce2 APN 9 95692923 missense probably damaging 0.98
IGL03339:Pcolce2 APN 9 95678340 splice site probably benign
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0570:Pcolce2 UTSW 9 95638657 missense probably benign 0.00
R0962:Pcolce2 UTSW 9 95670034 missense probably benign 0.04
R0989:Pcolce2 UTSW 9 95638723 missense probably benign 0.00
R1171:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R1840:Pcolce2 UTSW 9 95670117 missense probably damaging 0.98
R1840:Pcolce2 UTSW 9 95670203 missense probably benign 0.16
R1997:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R2061:Pcolce2 UTSW 9 95670176 missense probably benign 0.04
R2196:Pcolce2 UTSW 9 95694689 missense probably damaging 0.98
R2287:Pcolce2 UTSW 9 95678405 nonsense probably null
R4049:Pcolce2 UTSW 9 95638755 missense probably damaging 1.00
R4432:Pcolce2 UTSW 9 95681557 missense probably damaging 0.99
R4639:Pcolce2 UTSW 9 95637877 splice site probably null
R6288:Pcolce2 UTSW 9 95681593 missense probably damaging 0.96
R6625:Pcolce2 UTSW 9 95678439 nonsense probably null
R6883:Pcolce2 UTSW 9 95678343 critical splice acceptor site probably null
R7023:Pcolce2 UTSW 9 95678468 missense probably benign 0.19
R7066:Pcolce2 UTSW 9 95681621 missense probably benign
R7949:Pcolce2 UTSW 9 95694635 missense probably benign 0.11
R8325:Pcolce2 UTSW 9 95692920 missense probably damaging 1.00
R8369:Pcolce2 UTSW 9 95637794 start codon destroyed probably benign
Z1176:Pcolce2 UTSW 9 95637836 missense possibly damaging 0.83
Z1177:Pcolce2 UTSW 9 95678425 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCTGGGAAGTTACACCCAAAC -3'
(R):5'- TGGATCGTGTTTTAGCCCTTAC -3'

Sequencing Primer
(F):5'- AATTTGAGGTCCCTTATACGCG -3'
(R):5'- GGATCGTGTTTTAGCCCTTACTTCAC -3'
Posted On2014-12-29