Incidental Mutation 'R2922:Flii'
ID255587
Institutional Source Beutler Lab
Gene Symbol Flii
Ensembl Gene ENSMUSG00000002812
Gene Nameflightless I actin binding protein
SynonymsFliih, 3632430F08Rik
MMRRC Submission 040507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2922 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60714123-60727263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60718916 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 622 (Y622H)
Ref Sequence ENSEMBL: ENSMUSP00000002889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably damaging
Transcript: ENSMUST00000002889
AA Change: Y622H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812
AA Change: Y622H

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052346
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154465
Meta Mutation Damage Score 0.5486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a protein with gelsolin-like repeats and an N-terminal leucine-rich repeat domain. The protein is similar to a Drosophila protein involved in early embryogenesis and the structural organization of indirect flight muscle. This protein may act as an actin-remodelling protein as well as a transcriptional coactivator. Homozygous knockout mice show embryonic lethality. This protein may act to regulate wound repair. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are able to initiate uterine implantation but degenerate rapidly thereafter. Heterozygous mutant mice display enhanced wound healing with increased epithelial migration and improved wound contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Flii
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Flii APN 11 60723415 missense probably benign 0.03
IGL00331:Flii APN 11 60715833 missense probably benign 0.40
IGL01530:Flii APN 11 60720182 nonsense probably null
IGL01678:Flii APN 11 60716846 unclassified probably benign
IGL01938:Flii APN 11 60715116 missense probably damaging 1.00
IGL02211:Flii APN 11 60718298 unclassified probably benign
IGL02626:Flii APN 11 60719859 missense probably benign 0.37
IGL03038:Flii APN 11 60724832 missense probably benign 0.01
IGL03412:Flii APN 11 60722640 missense probably damaging 0.99
Dry_tortugas UTSW 11 60720757 nonsense probably null
R0135:Flii UTSW 11 60723378 missense probably damaging 0.99
R0350:Flii UTSW 11 60721857 missense probably damaging 1.00
R0355:Flii UTSW 11 60719680 splice site probably null
R0524:Flii UTSW 11 60720061 missense probably damaging 0.98
R0636:Flii UTSW 11 60715552 missense probably damaging 1.00
R0639:Flii UTSW 11 60722997 splice site probably null
R1515:Flii UTSW 11 60721606 critical splice acceptor site probably null
R1544:Flii UTSW 11 60719692 critical splice donor site probably null
R1782:Flii UTSW 11 60714636 missense probably benign
R3691:Flii UTSW 11 60719757 missense probably benign 0.03
R3753:Flii UTSW 11 60715480 missense probably benign
R3875:Flii UTSW 11 60720492 missense probably benign
R3876:Flii UTSW 11 60719872 missense possibly damaging 0.85
R3924:Flii UTSW 11 60720076 missense probably damaging 1.00
R4621:Flii UTSW 11 60716111 missense possibly damaging 0.95
R4789:Flii UTSW 11 60715093 missense probably benign 0.33
R5153:Flii UTSW 11 60716686 missense possibly damaging 0.89
R5326:Flii UTSW 11 60718862 missense probably benign 0.30
R5340:Flii UTSW 11 60717268 missense probably damaging 0.99
R5364:Flii UTSW 11 60720128 missense probably benign 0.00
R5542:Flii UTSW 11 60718862 missense probably benign 0.30
R5592:Flii UTSW 11 60720399 missense probably benign 0.00
R5859:Flii UTSW 11 60716311 nonsense probably null
R5968:Flii UTSW 11 60720212 missense probably benign
R6009:Flii UTSW 11 60720757 nonsense probably null
R6287:Flii UTSW 11 60721597 missense probably damaging 1.00
R6368:Flii UTSW 11 60721136 missense probably damaging 1.00
R6997:Flii UTSW 11 60722325 missense probably benign 0.14
R7099:Flii UTSW 11 60720655 missense probably benign 0.05
R7324:Flii UTSW 11 60719040 missense probably benign
R7366:Flii UTSW 11 60721119 missense possibly damaging 0.67
R7371:Flii UTSW 11 60718264 missense probably benign 0.41
R7571:Flii UTSW 11 60721136 missense probably damaging 1.00
R7669:Flii UTSW 11 60722664 missense probably damaging 1.00
R7677:Flii UTSW 11 60720145 missense probably damaging 0.99
R7698:Flii UTSW 11 60720092 missense probably damaging 1.00
X0025:Flii UTSW 11 60721708 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACTCAAAAGATGGGGCTCTGG -3'
(R):5'- CAATGACATCTCCTACATTGAAGGC -3'

Sequencing Primer
(F):5'- AAAAGATGGGGCTCTGGTTCCC -3'
(R):5'- TCTCCTACATTGAAGGCGGAACAG -3'
Posted On2014-12-29