Mutagenetix > Incidental Mutations

Incidental Mutation 'R0318:C3'

25560

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000024164

Gene Name

complement component 3

Synonyms

complement factor 3, acylation stimulating protein, Plp

MMRRC Submission

038528-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57203970-57228136 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 57224709 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 272 (V272M)

Ref Sequence

ENSEMBL: ENSMUSP00000024988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024988
AA Change: V272M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: V272M

Domain	Start	End	E-Value	Type
low complexity region	4	23	N/A	INTRINSIC
Pfam:A2M_N	130	225	3.8e-17	PFAM
A2M_N_2	456	604	5.22e-38	SMART
ANATO	693	728	5.69e-15	SMART
low complexity region	752	762	N/A	INTRINSIC
A2M	770	866	5.47e-32	SMART
Pfam:Thiol-ester_cl	1000	1028	4.6e-15	PFAM
Pfam:A2M_comp	1051	1284	7.3e-60	PFAM
A2M_recep	1398	1493	3.98e-43	SMART
C345C	1533	1645	1.85e-48	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176457

Predicted Effect

probably benign
Transcript: ENSMUST00000177046

Predicted Effect

probably benign
Transcript: ENSMUST00000177425

SMART Domains

Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

Domain	Start	End	E-Value	Type
Pfam:A2M_N_2	1	55	1.6e-10	PFAM
PDB:3L5N\|B	74	102	1e-9	PDB

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.4%
20x: 86.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,974	L79Q	probably damaging	Het
Add1	T	C	5: 34,625,340	V130A	probably damaging	Het
Ankrd23	G	T	1: 36,534,072	T73K	probably benign	Het
BC005561	T	C	5: 104,517,753	F47S	probably benign	Het
Blk	A	G	14: 63,374,197	Y430H	probably damaging	Het
Cerk	C	T	15: 86,151,565	A254T	possibly damaging	Het
Ces2a	G	A	8: 104,740,824	A494T	probably damaging	Het
Cfap46	T	C	7: 139,654,566	Y258C	probably damaging	Het
Chaf1a	C	T	17: 56,062,227	T486I	possibly damaging	Het
Colec12	A	G	18: 9,848,446	N208S	possibly damaging	Het
Coro7	T	A	16: 4,675,807	H63L	probably benign	Het
Cps1	T	A	1: 67,177,014	W833R	probably damaging	Het
Csmd3	A	T	15: 47,659,153	W2707R	probably damaging	Het
Dbn1	C	T	13: 55,474,916	E585K	probably damaging	Het
Ddx50	A	T	10: 62,642,837	I190K	probably damaging	Het
Dnmt3l	G	A	10: 78,055,055	V264M	probably damaging	Het
Dnpep	A	G	1: 75,316,626	V33A	probably damaging	Het
Fam163a	A	G	1: 156,079,969	C26R	probably damaging	Het
Fam83h	A	G	15: 76,003,629	S620P	probably benign	Het
Fcna	A	G	2: 25,625,059	S263P	probably benign	Het
Fnip2	A	T	3: 79,512,378	S165R	probably damaging	Het
Fpr-rs3	T	C	17: 20,624,148	T244A	probably benign	Het
Gpr152	T	C	19: 4,143,542	S361P	possibly damaging	Het
Grm5	A	T	7: 87,602,967	I142L	probably damaging	Het
Gucy2g	A	G	19: 55,237,798	S229P	probably benign	Het
Htr7	C	T	19: 35,969,486	G376D	probably damaging	Het
Irgc1	T	C	7: 24,432,471	D307G	probably benign	Het
Irs1	A	T	1: 82,288,660	S612T	probably benign	Het
Maml2	C	T	9: 13,620,594	T368I	probably damaging	Het
Mapkapk2	A	G	1: 131,097,335	V64A	probably damaging	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Nptx1	C	T	11: 119,542,541	E411K	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr995	C	A	2: 85,438,237	R307M	possibly damaging	Het
Pcgf5	A	T	19: 36,412,190	K22N	possibly damaging	Het
Psmd9	C	A	5: 123,234,649	A65E	possibly damaging	Het
Sh3bp1	A	G	15: 78,911,707	T679A	probably damaging	Het
Sipa1l2	G	A	8: 125,447,697	P1281S	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc25a24	A	G	3: 109,157,000	M222V	probably benign	Het
Smg9	T	C	7: 24,420,888	F429S	possibly damaging	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sorl1	T	A	9: 42,081,954	Y258F	probably damaging	Het
Srp72	C	T	5: 76,984,200	T242I	probably benign	Het
Stc1	A	T	14: 69,038,418	Q220L	probably damaging	Het
Tas2r122	T	C	6: 132,711,832	T33A	possibly damaging	Het
Tbc1d10b	A	G	7: 127,199,034	L645P	probably damaging	Het
Timd4	T	A	11: 46,837,071	H272Q	probably benign	Het
Ttll5	T	G	12: 85,876,594		probably null	Het
Veph1	G	T	3: 66,057,259	S783Y	probably damaging	Het
Vmn1r230	T	C	17: 20,846,816	L89S	possibly damaging	Het
Xcr1	A	G	9: 123,856,154	V165A	possibly damaging	Het
Zfp286	T	C	11: 62,784,962	D58G	probably damaging	Het
Zfyve26	C	T	12: 79,276,281	R897H	probably damaging	Het

Other mutations in C3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:C3	APN	17	57226004	missense	probably benign	0.01
IGL00741:C3	APN	17	57220206	intron	probably benign
IGL01093:C3	APN	17	57223949	missense	probably damaging	1.00
IGL01309:C3	APN	17	57209652	intron	probably benign
IGL01312:C3	APN	17	57225993	unclassified	probably benign
IGL01344:C3	APN	17	57224880	missense	probably benign
IGL01514:C3	APN	17	57215866	missense	probably benign	0.04
IGL01913:C3	APN	17	57213767	missense	probably null	0.01
IGL02165:C3	APN	17	57225092	missense	probably benign	0.17
IGL02176:C3	APN	17	57226337	unclassified	probably benign
IGL02189:C3	APN	17	57220113	missense	probably benign	0.01
IGL02378:C3	APN	17	57212698	missense	probably benign	0.19
IGL02422:C3	APN	17	57226823	missense	probably damaging	0.98
IGL02715:C3	APN	17	57204158	intron	probably benign
IGL02737:C3	APN	17	57204281	missense	probably benign	0.08
IGL03201:C3	APN	17	57222249	missense	probably damaging	1.00
IGL03210:C3	APN	17	57215846	nonsense	probably null
IGL03345:C3	APN	17	57219585	missense	probably damaging	1.00
PIT4431001:C3	UTSW	17	57206242	missense	probably benign	0.00
PIT4494001:C3	UTSW	17	57209263	missense	probably benign	0.01
R0158:C3	UTSW	17	57224851	critical splice donor site	probably null
R1132:C3	UTSW	17	57207531	critical splice donor site	probably null
R1765:C3	UTSW	17	57224401	splice site	probably null
R1793:C3	UTSW	17	57219592	missense	possibly damaging	0.93
R1852:C3	UTSW	17	57222823	missense	probably damaging	0.98
R1908:C3	UTSW	17	57209489	missense	probably damaging	1.00
R1919:C3	UTSW	17	57220135	missense	probably damaging	1.00
R1935:C3	UTSW	17	57218829	missense	probably damaging	1.00
R2026:C3	UTSW	17	57218562	missense	probably damaging	1.00
R2108:C3	UTSW	17	57223974	splice site	probably null
R2197:C3	UTSW	17	57219623	missense	probably benign	0.32
R2394:C3	UTSW	17	57222303	nonsense	probably null
R2998:C3	UTSW	17	57210284	missense	probably benign	0.00
R3727:C3	UTSW	17	57207379	missense	possibly damaging	0.50
R3767:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3768:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3769:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3770:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R3784:C3	UTSW	17	57226067	missense	probably damaging	0.99
R3883:C3	UTSW	17	57217173	critical splice acceptor site	probably null
R3884:C3	UTSW	17	57217173	critical splice acceptor site	probably null
R3950:C3	UTSW	17	57225286	missense	probably benign	0.02
R3966:C3	UTSW	17	57218664	missense	probably damaging	0.99
R4077:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4078:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4079:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4168:C3	UTSW	17	57218608	missense	probably benign	0.00
R4208:C3	UTSW	17	57205303	missense	possibly damaging	0.96
R4695:C3	UTSW	17	57221057	missense	probably benign
R4909:C3	UTSW	17	57226830	critical splice donor site	probably null
R5011:C3	UTSW	17	57223236	missense	probably benign	0.06
R5094:C3	UTSW	17	57225033	critical splice donor site	probably null
R5141:C3	UTSW	17	57219570	missense	probably damaging	0.98
R5170:C3	UTSW	17	57223938	missense	probably damaging	0.96
R5339:C3	UTSW	17	57224308	missense	probably damaging	0.99
R5369:C3	UTSW	17	57221159	missense	probably benign	0.45
R5412:C3	UTSW	17	57220187	missense	probably benign	0.01
R5439:C3	UTSW	17	57204502	missense	probably benign	0.28
R5463:C3	UTSW	17	57211720	missense	probably benign	0.08
R5546:C3	UTSW	17	57222976	missense	probably damaging	0.99
R5572:C3	UTSW	17	57224673	missense	probably damaging	0.99
R5851:C3	UTSW	17	57211612	missense	probably null	0.14
R5863:C3	UTSW	17	57223141	missense	probably benign	0.06
R5888:C3	UTSW	17	57214831	missense	probably damaging	1.00
R5940:C3	UTSW	17	57210244	missense	possibly damaging	0.64
R6073:C3	UTSW	17	57206223	missense	probably null
R6091:C3	UTSW	17	57221967	nonsense	probably null
R6286:C3	UTSW	17	57224118	missense	probably damaging	1.00
R6524:C3	UTSW	17	57217264	critical splice donor site	probably null
R6868:C3	UTSW	17	57204029	missense	possibly damaging	0.55
R6896:C3	UTSW	17	57220864	splice site	probably null
R7007:C3	UTSW	17	57218809	missense	probably benign	0.00
R7022:C3	UTSW	17	57217286	missense	probably damaging	1.00
R7099:C3	UTSW	17	57206276	missense	probably benign	0.28
R7117:C3	UTSW	17	57212655	missense	probably benign	0.01
R7347:C3	UTSW	17	57223215	missense	probably benign	0.09
R7366:C3	UTSW	17	57221162	missense	probably benign	0.00
R7423:C3	UTSW	17	57214767	missense	probably damaging	1.00
R7425:C3	UTSW	17	57204039	missense	possibly damaging	0.81
R7481:C3	UTSW	17	57220136	missense	probably damaging	1.00
R7540:C3	UTSW	17	57206220	missense	probably benign	0.01
R7746:C3	UTSW	17	57218859	missense	probably damaging	1.00
R7771:C3	UTSW	17	57215797	missense	probably damaging	1.00
R7884:C3	UTSW	17	57226264	missense	probably benign	0.05
R8144:C3	UTSW	17	57226276	missense	probably damaging	0.98
R8279:C3	UTSW	17	57215809	missense	probably benign	0.28
R8284:C3	UTSW	17	57223938	missense	probably benign	0.39
R8328:C3	UTSW	17	57220973	missense	probably benign	0.00
R8353:C3	UTSW	17	57212643	missense	probably benign	0.00
R8396:C3	UTSW	17	57221029	missense	probably benign
R8429:C3	UTSW	17	57222811	missense	probably damaging	1.00
R8453:C3	UTSW	17	57212643	missense	probably benign	0.00
R8557:C3	UTSW	17	57224383	missense	probably benign	0.00
R8738:C3	UTSW	17	57204015	makesense	probably null
Z1177:C3	UTSW	17	57217144	missense	probably benign	0.07
Z1177:C3	UTSW	17	57226171	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTCAGCAAGGTGAGTGACTGGTAG -3'
(R):5'- TCTCCGCAGAGTTTGAGGTGAAGG -3'

Sequencing Primer
(F):5'- TGACTGGTAGGGGCACTAAG -3'
(R):5'- AGCCACACCCAGAGAAGTCT -3'

Posted On

2013-04-16