Incidental Mutation 'R2923:Wisp2'
ID 255608
Institutional Source Beutler Lab
Gene Symbol Wisp2
Ensembl Gene ENSMUSG00000027656
Gene Name WNT1 inducible signaling pathway protein 2
Synonyms rCop1, Crgr4, CCN5
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2923 (G1)
Quality Score 207
Status Validated
Chromosome 2
Chromosomal Location 163820861-163833146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 163832346 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 222 (R222Q)
Ref Sequence ENSEMBL: ENSMUSP00000029188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029188]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029188
AA Change: R222Q

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029188
Gene: ENSMUSG00000027656
AA Change: R222Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 24 93 1.67e-16 SMART
VWC 100 163 5.9e-16 SMART
TSP1 195 239 9.68e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138730
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viabe and overtly normal with no adult bone phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Wisp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Wisp2 APN 2 163829022 missense probably damaging 1.00
BB002:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
BB012:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R0336:Wisp2 UTSW 2 163832322 missense probably damaging 0.98
R0600:Wisp2 UTSW 2 163825313 missense probably damaging 1.00
R1241:Wisp2 UTSW 2 163829077 missense unknown
R1779:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R2921:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R4049:Wisp2 UTSW 2 163828984 missense probably damaging 1.00
R4344:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R5409:Wisp2 UTSW 2 163825238 missense probably damaging 1.00
R5529:Wisp2 UTSW 2 163825359 critical splice donor site probably null
R5663:Wisp2 UTSW 2 163825253 missense probably damaging 1.00
R6401:Wisp2 UTSW 2 163829026 missense probably benign 0.45
R6685:Wisp2 UTSW 2 163828948 missense possibly damaging 0.87
R7242:Wisp2 UTSW 2 163828852 missense probably benign 0.27
R7925:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R8066:Wisp2 UTSW 2 163828942 missense probably damaging 1.00
R8701:Wisp2 UTSW 2 163828866 missense probably damaging 1.00
R8962:Wisp2 UTSW 2 163825240 nonsense probably null
R9215:Wisp2 UTSW 2 163829046 missense probably damaging 1.00
R9656:Wisp2 UTSW 2 163829065 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAAGCCTAACAGCCTCTCCAG -3'
(R):5'- AGAGGGGCATCTACCATCAG -3'

Sequencing Primer
(F):5'- AGGTTCCCTGTGATGGCCAG -3'
(R):5'- GGGCATCTACCATCAGTCCAG -3'
Posted On 2014-12-29