Incidental Mutation 'R2923:Kcnk3'
ID255615
Institutional Source Beutler Lab
Gene Symbol Kcnk3
Ensembl Gene ENSMUSG00000049265
Gene Namepotassium channel, subfamily K, member 3
SynonymscTBAK-1, Task-1
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R2923 (G1)
Quality Score178
Status Validated
Chromosome5
Chromosomal Location30588170-30625271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30622070 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 155 (S155P)
Ref Sequence ENSEMBL: ENSMUSP00000098987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066295]
Predicted Effect probably damaging
Transcript: ENSMUST00000066295
AA Change: S155P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098987
Gene: ENSMUSG00000049265
AA Change: S155P

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:Ion_trans_2 58 134 2.9e-20 PFAM
Pfam:Ion_trans_2 165 248 1.4e-21 PFAM
low complexity region 272 286 N/A INTRINSIC
low complexity region 296 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197428
Meta Mutation Damage Score 0.6454 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null alleles exhibit decreased pH sensitivitive of action potential in serotonergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Kcnk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Kcnk3 APN 5 30622383 missense probably damaging 0.99
IGL02719:Kcnk3 APN 5 30621980 missense probably damaging 1.00
PIT4802001:Kcnk3 UTSW 5 30622368 missense probably damaging 1.00
R0288:Kcnk3 UTSW 5 30588420 missense probably benign
R0834:Kcnk3 UTSW 5 30622635 missense probably damaging 1.00
R1740:Kcnk3 UTSW 5 30621977 missense possibly damaging 0.95
R2656:Kcnk3 UTSW 5 30622671 missense possibly damaging 0.55
R3740:Kcnk3 UTSW 5 30621930 missense possibly damaging 0.93
R4584:Kcnk3 UTSW 5 30588386 missense probably damaging 0.99
R5010:Kcnk3 UTSW 5 30622805 missense possibly damaging 0.79
R5070:Kcnk3 UTSW 5 30622386 missense possibly damaging 0.77
R5427:Kcnk3 UTSW 5 30622295 missense possibly damaging 0.86
R5669:Kcnk3 UTSW 5 30622349 missense probably damaging 0.99
R5956:Kcnk3 UTSW 5 30588510 missense probably damaging 1.00
R5982:Kcnk3 UTSW 5 30622670 missense probably benign 0.18
R5986:Kcnk3 UTSW 5 30588378 missense possibly damaging 0.68
R6318:Kcnk3 UTSW 5 30622586 missense probably damaging 0.98
R6860:Kcnk3 UTSW 5 30622053 missense possibly damaging 0.86
R6919:Kcnk3 UTSW 5 30622400 missense probably benign 0.00
R7350:Kcnk3 UTSW 5 30621966 missense probably damaging 1.00
R7418:Kcnk3 UTSW 5 30622331 missense possibly damaging 0.57
R7502:Kcnk3 UTSW 5 30622718 missense possibly damaging 0.85
Z1177:Kcnk3 UTSW 5 30588274 start gained probably benign
Z1177:Kcnk3 UTSW 5 30622493 missense probably benign
Z1177:Kcnk3 UTSW 5 30622704 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCTCTACAGGCTATGGTCATGC -3'
(R):5'- GAAGCTGAAGGCCACATACTG -3'

Sequencing Primer
(F):5'- TATGGTCATGCGGCGCC -3'
(R):5'- AGGCCACATACTGCGGCTG -3'
Posted On2014-12-29