Incidental Mutation 'R0318:Colec12'
ID25562
Institutional Source Beutler Lab
Gene Symbol Colec12
Ensembl Gene ENSMUSG00000036103
Gene Namecollectin sub-family member 12
SynonymsCL-P1, SRCL, Scara4
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R0318 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9707648-9877995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9848446 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 208 (N208S)
Ref Sequence ENSEMBL: ENSMUSP00000043220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040069]
PDB Structure
Mouse Scavenger Receptor C-type Lectin carbohydrate-recognition domain. [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040069
AA Change: N208S

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043220
Gene: ENSMUSG00000036103
AA Change: N208S

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 112 157 N/A INTRINSIC
low complexity region 205 211 N/A INTRINSIC
coiled coil region 217 247 N/A INTRINSIC
low complexity region 268 280 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
Pfam:Collagen 441 499 1.4e-10 PFAM
Pfam:Collagen 482 548 9.6e-10 PFAM
Pfam:Collagen 530 591 3.8e-11 PFAM
CLECT 607 731 4.19e-36 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. This protein is a scavenger receptor, a cell surface glycoprotein that displays several functions associated with host defense. It can bind to carbohydrate antigens on microorganisms, facilitating their recognition and removal. It also mediates the recognition, internalization, and degradation of oxidatively modified low density lipoprotein by vascular endothelial cells. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
C3 C T 17: 57,224,709 V272M probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in Colec12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Colec12 APN 18 9848826 missense probably damaging 1.00
IGL02477:Colec12 APN 18 9859858 missense unknown
R0128:Colec12 UTSW 18 9858921 missense unknown
R0130:Colec12 UTSW 18 9858921 missense unknown
R0178:Colec12 UTSW 18 9858921 missense unknown
R0179:Colec12 UTSW 18 9858921 missense unknown
R0180:Colec12 UTSW 18 9848890 missense probably damaging 0.99
R0180:Colec12 UTSW 18 9858921 missense unknown
R0344:Colec12 UTSW 18 9858921 missense unknown
R0573:Colec12 UTSW 18 9858650 missense probably damaging 0.97
R1028:Colec12 UTSW 18 9866837 missense unknown
R1693:Colec12 UTSW 18 9866765 missense unknown
R1951:Colec12 UTSW 18 9859975 critical splice donor site probably null
R2008:Colec12 UTSW 18 9874813 missense probably benign 0.03
R2181:Colec12 UTSW 18 9846828 missense probably damaging 0.99
R4258:Colec12 UTSW 18 9720950 missense probably damaging 1.00
R4794:Colec12 UTSW 18 9848984 missense probably damaging 0.99
R5269:Colec12 UTSW 18 9846825 missense possibly damaging 0.67
R5369:Colec12 UTSW 18 9866750 missense unknown
R5421:Colec12 UTSW 18 9858580 missense probably damaging 1.00
R5608:Colec12 UTSW 18 9848267 missense possibly damaging 0.95
R5668:Colec12 UTSW 18 9848963 missense probably damaging 1.00
R5684:Colec12 UTSW 18 9849009 missense probably damaging 0.99
R6547:Colec12 UTSW 18 9840351 missense probably damaging 1.00
R7194:Colec12 UTSW 18 9848248 missense probably benign 0.08
R7253:Colec12 UTSW 18 9848922 missense probably damaging 1.00
Z1088:Colec12 UTSW 18 9848727 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCAAGCAAATGGGGACTCATTGG -3'
(R):5'- CTGACCTGTGAATGAGCTGAGCTG -3'

Sequencing Primer
(F):5'- ACTCATTGGTTGATAGGCAGAGTC -3'
(R):5'- GCCAATGTCTGCAAGCTCTG -3'
Posted On2013-04-16