Incidental Mutation 'R2923:St8sia1'
ID255621
Institutional Source Beutler Lab
Gene Symbol St8sia1
Ensembl Gene ENSMUSG00000030283
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
SynonymsST8Sia I, Siat8, Siat8a, GD3S, GD3 synthase, 9330109E03Rik, alpha-2,8-sialyltransferase
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142821545-142964452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142829237 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 205 (F205L)
Ref Sequence ENSEMBL: ENSMUSP00000032421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032421] [ENSMUST00000205149]
Predicted Effect probably damaging
Transcript: ENSMUST00000032421
AA Change: F205L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032421
Gene: ENSMUSG00000030283
AA Change: F205L

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Glyco_transf_29 90 344 8.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147058
Predicted Effect probably benign
Transcript: ENSMUST00000205149
SMART Domains Protein: ENSMUSP00000145148
Gene: ENSMUSG00000030283

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
transmembrane domain 76 95 N/A INTRINSIC
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted allele are behaviorally normal with no signs of aberrant brain histology or demyelination. Homozygotes for a knock-out allele are behaviorally intact with normal nervous tissue morphology and sensitivity to Fas-mediated apoptosis but show impaired repair of damaged nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in St8sia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:St8sia1 APN 6 142829227 missense probably benign 0.00
IGL02138:St8sia1 APN 6 142963778 utr 5 prime probably benign
IGL02419:St8sia1 APN 6 142828935 missense probably damaging 1.00
IGL03407:St8sia1 APN 6 142914049 missense possibly damaging 0.80
PIT4453001:St8sia1 UTSW 6 142829252 nonsense probably null
PIT4498001:St8sia1 UTSW 6 142914122 missense probably damaging 1.00
R0167:St8sia1 UTSW 6 142914181 splice site probably benign
R0690:St8sia1 UTSW 6 142829254 missense probably damaging 1.00
R1727:St8sia1 UTSW 6 142876727 missense probably damaging 0.99
R1743:St8sia1 UTSW 6 142829016 missense probably damaging 1.00
R1937:St8sia1 UTSW 6 142963672 missense probably damaging 1.00
R2983:St8sia1 UTSW 6 142963629 missense probably damaging 0.99
R3824:St8sia1 UTSW 6 142829025 missense probably damaging 1.00
R4803:St8sia1 UTSW 6 142867923 missense probably benign 0.04
R4844:St8sia1 UTSW 6 142829270 missense possibly damaging 0.82
R4865:St8sia1 UTSW 6 142829070 missense probably damaging 1.00
R4886:St8sia1 UTSW 6 142914134 missense probably damaging 0.99
R5170:St8sia1 UTSW 6 142963708 missense probably damaging 0.99
R5519:St8sia1 UTSW 6 142963561 missense probably damaging 0.99
R5783:St8sia1 UTSW 6 142963614 missense possibly damaging 0.83
R6713:St8sia1 UTSW 6 142829282 splice site probably null
R7017:St8sia1 UTSW 6 142867906 missense probably damaging 0.98
R7144:St8sia1 UTSW 6 142876669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAACTTTCCAATGTTCCG -3'
(R):5'- GAGCTTCATTGAGGAATGTTGACG -3'

Sequencing Primer
(F):5'- TTCCAATGTTCCGAAGAAAGTTGGG -3'
(R):5'- CATTGAGGAATGTTGACGAGTTC -3'
Posted On2014-12-29