Incidental Mutation 'R2923:Olfr644'
ID255623
Institutional Source Beutler Lab
Gene Symbol Olfr644
Ensembl Gene ENSMUSG00000110012
Gene Nameolfactory receptor 644
SynonymsGA_x6K02T2PBJ9-6803062-6802118, MOR13-1
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104066289-104071869 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104068587 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000149600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077417] [ENSMUST00000138055] [ENSMUST00000213184] [ENSMUST00000213991]
Predicted Effect probably benign
Transcript: ENSMUST00000077417
AA Change: V148A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000076633
Gene: ENSMUSG00000110012
AA Change: V148A

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 256 5.9e-8 PFAM
Pfam:7tm_1 43 294 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213184
AA Change: V148A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213991
AA Change: V148A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Olfr644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Olfr644 APN 7 104068369 missense probably benign 0.00
IGL02937:Olfr644 APN 7 104068849 missense probably damaging 0.99
IGL03188:Olfr644 APN 7 104068738 missense possibly damaging 0.89
FR4737:Olfr644 UTSW 7 104071292 start gained probably benign
R0467:Olfr644 UTSW 7 104068125 missense probably benign 0.07
R1310:Olfr644 UTSW 7 104068598 missense probably benign
R1457:Olfr644 UTSW 7 104068459 missense probably damaging 1.00
R1619:Olfr644 UTSW 7 104068531 missense probably damaging 1.00
R1874:Olfr644 UTSW 7 104068129 missense probably null 1.00
R2428:Olfr644 UTSW 7 104068468 nonsense probably null
R2922:Olfr644 UTSW 7 104068587 missense probably benign 0.09
R3929:Olfr644 UTSW 7 104068584 missense probably benign 0.06
R4500:Olfr644 UTSW 7 104068195 missense probably damaging 1.00
R5035:Olfr644 UTSW 7 104068407 missense possibly damaging 0.95
R5303:Olfr644 UTSW 7 104069032 utr 5 prime probably benign
R5464:Olfr644 UTSW 7 104068467 missense possibly damaging 0.72
R5722:Olfr644 UTSW 7 104068723 missense probably damaging 1.00
R5742:Olfr644 UTSW 7 104068205 missense probably damaging 0.97
R6874:Olfr644 UTSW 7 104068189 missense possibly damaging 0.50
R6940:Olfr644 UTSW 7 104068413 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATGAGTGCAGAATCCAGCCC -3'
(R):5'- TGCCTACAGTTCTGGGAGTG -3'

Sequencing Primer
(F):5'- TCCAGCCCAAAGGTAGAGATGAC -3'
(R):5'- GAGTGTTTTGTTTTCACTTAAGAGAG -3'
Posted On2014-12-29