Mutagenetix > Incidental Mutation

Incidental Mutation 'R2923:Golga4'

255626

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

040508-MU

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2923 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118559343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1844 (S1844R)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084820
AA Change: S1844R

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: S1844R

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000211840
AA Change: S854R

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	A	T	12: 81,420,744	C368S	probably damaging	Het
Adamts3	T	C	5: 89,861,534	D90G	possibly damaging	Het
Astn2	T	C	4: 65,913,773	Y500C	probably damaging	Het
Atp12a	A	T	14: 56,374,622	T418S	probably benign	Het
Atp6v0a2	C	T	5: 124,717,917	T656M	possibly damaging	Het
Camsap2	G	A	1: 136,280,809	P971S	possibly damaging	Het
Ccdc116	T	C	16: 17,142,443	H170R	probably benign	Het
Clpb	A	G	7: 101,722,828	D257G	probably benign	Het
Cpb2	T	C	14: 75,256,033		probably null	Het
D430041D05Rik	G	A	2: 104,255,315	T164I	possibly damaging	Het
Dhx40	T	G	11: 86,789,263	Q416P	probably benign	Het
Dnah17	A	G	11: 118,093,547	F1636S	probably damaging	Het
Fhl3	T	C	4: 124,705,670	S13P	probably damaging	Het
Gapvd1	A	T	2: 34,688,863	I1249N	probably damaging	Het
Gm10604	C	T	4: 11,980,122	A61T	unknown	Het
Gm20939	T	A	17: 94,877,293	H456Q	probably damaging	Het
Grm6	G	C	11: 50,864,521	G827R	probably damaging	Het
Grm7	T	A	6: 111,495,905		probably null	Het
Hdc	G	A	2: 126,593,990	P654S	probably damaging	Het
Hoxb1	T	C	11: 96,366,293	L156P	probably benign	Het
Ipo9	G	T	1: 135,400,129	Q515K	probably benign	Het
Kcnk3	T	C	5: 30,622,070	S155P	probably damaging	Het
Mboat2	T	A	12: 24,954,240	W347R	probably damaging	Het
Mib1	C	T	18: 10,760,831	Q374*	probably null	Het
Ncor2	A	G	5: 125,055,791	F44S	probably damaging	Het
Nipal3	A	T	4: 135,477,465	I125N	probably damaging	Het
Olfr1218	A	G	2: 89,054,499	V309A	probably benign	Het
Olfr644	A	G	7: 104,068,587	V148A	probably benign	Het
Ovch2	A	G	7: 107,790,389	L317P	possibly damaging	Het
Pnpla2	T	A	7: 141,455,467	C61S	probably benign	Het
Ppp1r16b	G	T	2: 158,756,957	L312F	probably damaging	Het
Rdm1	T	A	11: 101,630,890	L157H	possibly damaging	Het
Rpl22	C	A	4: 152,327,545	T26N	possibly damaging	Het
Rptn	A	G	3: 93,398,708	Y1116C	possibly damaging	Het
Serpinb5	G	A	1: 106,876,040	S152N	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
St8sia1	A	T	6: 142,829,237	F205L	probably damaging	Het
Stab2	A	G	10: 86,861,461	Y1988H	probably damaging	Het
Susd3	A	T	13: 49,248,469	M1K	probably null	Het
Syne3	A	T	12: 104,968,084	L55Q	probably damaging	Het
Tmem2	A	G	19: 21,817,939	D732G	possibly damaging	Het
Tmx1	T	A	12: 70,466,121	C268S	probably benign	Het
Ttll1	T	C	15: 83,492,559	K321R	probably damaging	Het
Wisp2	G	A	2: 163,832,346	R222Q	probably benign	Het
Zdhhc18	G	T	4: 133,633,144	H82Q	probably benign	Het
Zhx1	T	C	15: 58,053,681	I390V	probably damaging	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CGCTCTCTGGAAAGTTAGACTGC -3'
(R):5'- ATTGGGAGTTTTCCTCAGGCC -3'

Sequencing Primer
(F):5'- CTCTCTGGAAAGTTAGACTGCACTAG -3'
(R):5'- CAGGCCTGTCTTCCAACAC -3'

Posted On

2014-12-29