Incidental Mutation 'R2923:Rdm1'
ID255631
Institutional Source Beutler Lab
Gene Symbol Rdm1
Ensembl Gene ENSMUSG00000010362
Gene NameRAD52 motif 1
SynonymsRad52b, 2410008M22Rik
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101627195-101636100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101630890 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 157 (L157H)
Ref Sequence ENSEMBL: ENSMUSP00000010506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010506
AA Change: L157H

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010506
Gene: ENSMUSG00000010362
AA Change: L157H

DomainStartEndE-ValueType
RRM 16 94 6.2e-6 SMART
low complexity region 248 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083833
Predicted Effect unknown
Transcript: ENSMUST00000133727
AA Change: L86H
SMART Domains Protein: ENSMUSP00000118996
Gene: ENSMUSG00000010362
AA Change: L86H

DomainStartEndE-ValueType
Pfam:Rad52_Rad22 14 118 1.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155222
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. The protein encoded by this gene contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. The RAD52 motif region in RAD52 is important for protein function and may be involved in DNA binding or oligomerization. Alternatively spliced transcript variants encoding different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Rdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Rdm1 APN 11 101635754 missense possibly damaging 0.58
IGL02153:Rdm1 APN 11 101628454 critical splice donor site probably null
IGL02589:Rdm1 APN 11 101628005 missense possibly damaging 0.80
R0532:Rdm1 UTSW 11 101635835 missense probably benign 0.11
R1111:Rdm1 UTSW 11 101633895 missense probably benign 0.19
R1532:Rdm1 UTSW 11 101633817 missense probably damaging 1.00
R1618:Rdm1 UTSW 11 101628391 missense possibly damaging 0.83
R1696:Rdm1 UTSW 11 101630868 missense probably benign 0.43
R2205:Rdm1 UTSW 11 101634803 missense probably damaging 1.00
R2921:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R2922:Rdm1 UTSW 11 101630890 missense possibly damaging 0.90
R4327:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R4329:Rdm1 UTSW 11 101630908 missense probably damaging 1.00
R6364:Rdm1 UTSW 11 101630242 missense probably benign 0.01
R7109:Rdm1 UTSW 11 101633828 missense probably damaging 1.00
X0010:Rdm1 UTSW 11 101627970 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- CTCCATTGAGTTCTCCAGCAAG -3'
(R):5'- GGCTAGTAGCTGACAACAAGTG -3'

Sequencing Primer
(F):5'- CTGGGGCTGGGGCTAAGTAATG -3'
(R):5'- CTAGTAGCTGACAACAAGTGGAGAG -3'
Posted On2014-12-29