Incidental Mutation 'R2923:Adam4'
ID255635
Institutional Source Beutler Lab
Gene Symbol Adam4
Ensembl Gene ENSMUSG00000072972
Gene Namea disintegrin and metallopeptidase domain 4
SynonymstMDCV
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81419443-81421946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81420744 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 368 (C368S)
Ref Sequence ENSEMBL: ENSMUSP00000082427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085319] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably damaging
Transcript: ENSMUST00000085319
AA Change: C368S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082427
Gene: ENSMUSG00000072972
AA Change: C368S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 9e-19 PFAM
Pfam:Reprolysin 213 406 1.3e-16 PFAM
DISIN 429 504 4.89e-37 SMART
ACR 505 648 2.28e-57 SMART
transmembrane domain 718 740 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Adam4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Adam4 APN 12 81420649 missense probably damaging 0.96
IGL01133:Adam4 APN 12 81421446 missense possibly damaging 0.53
IGL01636:Adam4 APN 12 81419949 missense possibly damaging 0.81
IGL02133:Adam4 APN 12 81420029 missense probably benign 0.37
IGL02137:Adam4 APN 12 81421103 missense possibly damaging 0.91
IGL02425:Adam4 APN 12 81421328 missense probably benign 0.07
IGL02686:Adam4 APN 12 81421674 missense possibly damaging 0.88
R0554:Adam4 UTSW 12 81421424 missense probably damaging 1.00
R0684:Adam4 UTSW 12 81419654 missense probably damaging 1.00
R1519:Adam4 UTSW 12 81420877 missense possibly damaging 0.67
R1636:Adam4 UTSW 12 81419690 missense probably damaging 0.98
R1795:Adam4 UTSW 12 81421294 missense probably benign 0.03
R1835:Adam4 UTSW 12 81419559 missense probably benign 0.00
R2158:Adam4 UTSW 12 81421763 missense probably damaging 1.00
R2393:Adam4 UTSW 12 81420711 missense probably benign 0.02
R3411:Adam4 UTSW 12 81419822 missense possibly damaging 0.64
R4159:Adam4 UTSW 12 81420032 missense probably damaging 0.99
R4509:Adam4 UTSW 12 81421747 nonsense probably null
R4673:Adam4 UTSW 12 81421761 missense possibly damaging 0.56
R4794:Adam4 UTSW 12 81421424 missense probably damaging 0.99
R5564:Adam4 UTSW 12 81419574 missense probably benign 0.00
R5774:Adam4 UTSW 12 81420686 missense probably damaging 1.00
R6054:Adam4 UTSW 12 81420054 missense probably damaging 0.99
R6722:Adam4 UTSW 12 81421454 missense probably damaging 1.00
R6857:Adam4 UTSW 12 81419949 missense possibly damaging 0.81
R7316:Adam4 UTSW 12 81419724 missense probably benign 0.08
R7393:Adam4 UTSW 12 81419660 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCACATTTCTCACTGGCC -3'
(R):5'- GCACGATTTGTATGCCACTACAG -3'

Sequencing Primer
(F):5'- ACTCTCTTATTTCCACAACGAGG -3'
(R):5'- GATTTGTATGCCACTACAGCTATTC -3'
Posted On2014-12-29