Mutagenetix > Incidental Mutations

Incidental Mutation 'R2924:Rbbp5'

255651

Institutional Source

Beutler Lab

Gene Symbol

Rbbp5

Ensembl Gene

ENSMUSG00000026439

Gene Name

retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit

Synonyms

4933411J24Rik

MMRRC Submission

040509-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R2924 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

132477365-132505659 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to C at 132492663 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000187505] [ENSMUST00000188575] [ENSMUST00000189786] [ENSMUST00000190825] [ENSMUST00000190997]

Predicted Effect

probably null
Transcript: ENSMUST00000027700

SMART Domains

Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

Domain	Start	End	E-Value	Type
WD40	14	52	2.31e-1	SMART
WD40	55	94	7.33e-7	SMART
Blast:WD40	97	177	2e-31	BLAST
WD40	182	226	8.29e-1	SMART
WD40	241	280	1.28e1	SMART
WD40	283	322	2.97e0	SMART
low complexity region	344	358	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000187505

SMART Domains

Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

Domain	Start	End	E-Value	Type
Blast:WD40	1	52	9e-13	BLAST
WD40	55	99	5.1e-3	SMART
WD40	114	153	7.9e-2	SMART
WD40	156	195	1.9e-2	SMART
low complexity region	217	231	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188575

SMART Domains

Protein: ENSMUSP00000140344
Gene: ENSMUSG00000026439

Domain	Start	End	E-Value	Type
Blast:WD40	14	55	9e-9	BLAST
SCOP:d1gxra_	34	87	8e-8	SMART
Blast:WD40	58	107	8e-16	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000189786

SMART Domains

Protein: ENSMUSP00000140790
Gene: ENSMUSG00000026439

Domain	Start	End	E-Value	Type
WD40	1	27	1.2e0	SMART
WD40	30	69	4.6e-9	SMART
Blast:WD40	72	149	2e-32	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000190825

SMART Domains

Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439

Domain	Start	End	E-Value	Type
WD40	14	52	1.4e-3	SMART
WD40	55	94	4.6e-9	SMART
Blast:WD40	97	177	2e-31	BLAST
WD40	182	226	5.1e-3	SMART
WD40	241	280	7.9e-2	SMART
WD40	283	322	1.9e-2	SMART
low complexity region	344	358	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000190997

SMART Domains

Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439

Domain	Start	End	E-Value	Type
WD40	14	52	2.31e-1	SMART
WD40	55	94	7.33e-7	SMART
Blast:WD40	97	177	2e-31	BLAST
WD40	182	226	8.29e-1	SMART
WD40	241	280	1.28e1	SMART
WD40	283	322	2.97e0	SMART
low complexity region	344	358	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. The encoded protein binds directly to retinoblastoma protein, which regulates cell proliferation. It interacts preferentially with the underphosphorylated retinoblastoma protein via the E1A-binding pocket B. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl9	A	G	3: 97,209,753	S542P	probably benign	Het
Cass4	A	G	2: 172,426,672	R225G	possibly damaging	Het
Ddx50	A	T	10: 62,627,594	V440E	probably damaging	Het
Dmrtc2	G	A	7: 24,872,516	C12Y	probably damaging	Het
Dock6	A	T	9: 21,809,630	I1693N	probably damaging	Het
Fuom	T	C	7: 140,099,949	T110A	probably benign	Het
Gli2	C	T	1: 118,836,359	R1354H	probably benign	Het
Gm5478	A	T	15: 101,643,794		probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Il2rb	T	C	15: 78,491,849	M1V	probably null	Het
Ints6l	A	G	X: 56,504,836	E483G	probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Man2b2	A	G	5: 36,824,102	F224L	probably benign	Het
Mrgpra1	G	A	7: 47,334,870		probably null	Het
Mtbp	G	A	15: 55,619,814	R429Q	probably benign	Het
Ncapg2	C	A	12: 116,438,729	T727K	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Nup214	A	G	2: 31,998,003	K15E	probably damaging	Het
Olfr394	A	G	11: 73,887,511	I287T	probably damaging	Het
Oxr1	T	C	15: 41,825,957	Y526H	probably benign	Het
Plec	A	G	15: 76,178,252	F2563S	probably damaging	Het
Prex2	A	G	1: 11,098,487	T236A	probably damaging	Het
Slc24a2	A	G	4: 87,011,724	S512P	probably benign	Het
Srd5a1	A	G	13: 69,586,715	S191P	probably damaging	Het
Syt3	T	A	7: 44,395,798	V518E	probably damaging	Het
Tmem132e	T	C	11: 82,444,323	S652P	probably damaging	Het
Uba6	A	T	5: 86,159,271	V102D	probably damaging	Het
Unc13a	A	G	8: 71,644,952	V1158A	possibly damaging	Het
Upk3a	A	G	15: 85,018,149	Y59C	probably benign	Het
Zc3hav1	T	C	6: 38,354,110	Y38C	probably damaging	Het
Zfp119a	C	A	17: 55,868,343	D51Y	possibly damaging	Het

Other mutations in Rbbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Rbbp5	APN	1	132489706	missense	probably damaging	1.00
IGL01373:Rbbp5	APN	1	132492601	missense	probably benign	0.07
IGL01577:Rbbp5	APN	1	132492655	missense	possibly damaging	0.68
IGL01728:Rbbp5	APN	1	132498080	missense	probably benign
R0097:Rbbp5	UTSW	1	132490489	missense	possibly damaging	0.81
R0420:Rbbp5	UTSW	1	132493844	missense	possibly damaging	0.88
R1540:Rbbp5	UTSW	1	132494282	nonsense	probably null
R1965:Rbbp5	UTSW	1	132494297	missense	probably damaging	1.00
R2419:Rbbp5	UTSW	1	132493826	missense	possibly damaging	0.95
R3810:Rbbp5	UTSW	1	132492587	missense	probably damaging	0.98
R3811:Rbbp5	UTSW	1	132492587	missense	probably damaging	0.98
R4234:Rbbp5	UTSW	1	132484758	missense	probably benign	0.08
R5024:Rbbp5	UTSW	1	132490488	missense	possibly damaging	0.65
R5166:Rbbp5	UTSW	1	132490565	missense	possibly damaging	0.60
R5435:Rbbp5	UTSW	1	132494275	missense	probably damaging	1.00
R6018:Rbbp5	UTSW	1	132494340	missense	probably damaging	1.00
R6172:Rbbp5	UTSW	1	132496816	missense	possibly damaging	0.89
R7500:Rbbp5	UTSW	1	132494141	missense	probably benign	0.35
X0019:Rbbp5	UTSW	1	132489698	missense	probably damaging	1.00
X0025:Rbbp5	UTSW	1	132489658	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAATTGTTACTAGGTCTCTTCACAG -3'
(R):5'- GGTCAGTGAGGGACATTTTATGAAC -3'

Sequencing Primer
(F):5'- GGTCTCTTCACAGTTAAAAACCAAG -3'
(R):5'- AACCCCAAAACCCCCAAAAACAG -3'

Posted On

2014-12-29