Incidental Mutation 'R2924:Rbbp5'
ID255651
Institutional Source Beutler Lab
Gene Symbol Rbbp5
Ensembl Gene ENSMUSG00000026439
Gene Nameretinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms4933411J24Rik
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132477365-132505659 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to C at 132492663 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000187505] [ENSMUST00000188575] [ENSMUST00000189786] [ENSMUST00000190825] [ENSMUST00000190997]
Predicted Effect probably null
Transcript: ENSMUST00000027700
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187505
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188575
SMART Domains Protein: ENSMUSP00000140344
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 14 55 9e-9 BLAST
SCOP:d1gxra_ 34 87 8e-8 SMART
Blast:WD40 58 107 8e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189786
SMART Domains Protein: ENSMUSP00000140790
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 1 27 1.2e0 SMART
WD40 30 69 4.6e-9 SMART
Blast:WD40 72 149 2e-32 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000190825
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190997
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. The encoded protein binds directly to retinoblastoma protein, which regulates cell proliferation. It interacts preferentially with the underphosphorylated retinoblastoma protein via the E1A-binding pocket B. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Rbbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Rbbp5 APN 1 132489706 missense probably damaging 1.00
IGL01373:Rbbp5 APN 1 132492601 missense probably benign 0.07
IGL01577:Rbbp5 APN 1 132492655 missense possibly damaging 0.68
IGL01728:Rbbp5 APN 1 132498080 missense probably benign
R0097:Rbbp5 UTSW 1 132490489 missense possibly damaging 0.81
R0420:Rbbp5 UTSW 1 132493844 missense possibly damaging 0.88
R1540:Rbbp5 UTSW 1 132494282 nonsense probably null
R1965:Rbbp5 UTSW 1 132494297 missense probably damaging 1.00
R2419:Rbbp5 UTSW 1 132493826 missense possibly damaging 0.95
R3810:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R3811:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R4234:Rbbp5 UTSW 1 132484758 missense probably benign 0.08
R5024:Rbbp5 UTSW 1 132490488 missense possibly damaging 0.65
R5166:Rbbp5 UTSW 1 132490565 missense possibly damaging 0.60
R5435:Rbbp5 UTSW 1 132494275 missense probably damaging 1.00
R6018:Rbbp5 UTSW 1 132494340 missense probably damaging 1.00
R6172:Rbbp5 UTSW 1 132496816 missense possibly damaging 0.89
R7500:Rbbp5 UTSW 1 132494141 missense probably benign 0.35
X0019:Rbbp5 UTSW 1 132489698 missense probably damaging 1.00
X0025:Rbbp5 UTSW 1 132489658 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATTGTTACTAGGTCTCTTCACAG -3'
(R):5'- GGTCAGTGAGGGACATTTTATGAAC -3'

Sequencing Primer
(F):5'- GGTCTCTTCACAGTTAAAAACCAAG -3'
(R):5'- AACCCCAAAACCCCCAAAAACAG -3'
Posted On2014-12-29