Incidental Mutation 'R2924:Bcl9'
ID255654
Institutional Source Beutler Lab
Gene Symbol Bcl9
Ensembl Gene ENSMUSG00000038256
Gene NameB cell CLL/lymphoma 9
Synonyms8030475K17Rik, A330041G23Rik, 2610202E01Rik
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97203662-97297917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97209753 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 542 (S542P)
Ref Sequence ENSEMBL: ENSMUSP00000131692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046521] [ENSMUST00000166341]
Predicted Effect probably benign
Transcript: ENSMUST00000046521
AA Change: S542P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046152
Gene: ENSMUSG00000038256
AA Change: S542P

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 389 3.1e-24 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141861
Predicted Effect probably benign
Transcript: ENSMUST00000166341
AA Change: S542P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131692
Gene: ENSMUSG00000038256
AA Change: S542P

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 388 5.2e-22 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of 1q21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Bcl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bcl9 APN 3 97207202 missense probably damaging 1.00
IGL00817:Bcl9 APN 3 97205144 missense probably damaging 0.97
IGL01609:Bcl9 APN 3 97208975 missense probably benign 0.23
IGL02245:Bcl9 APN 3 97208693 missense probably damaging 1.00
IGL02385:Bcl9 APN 3 97209278 missense probably benign 0.01
IGL02534:Bcl9 APN 3 97215229 missense probably damaging 1.00
IGL02663:Bcl9 APN 3 97205332 missense probably damaging 1.00
IGL02705:Bcl9 APN 3 97204865 missense possibly damaging 0.94
IGL02884:Bcl9 APN 3 97210052 missense probably damaging 1.00
IGL03345:Bcl9 APN 3 97209192 missense probably benign
R0312:Bcl9 UTSW 3 97209411 missense probably benign 0.27
R0602:Bcl9 UTSW 3 97205786 missense probably benign 0.00
R0627:Bcl9 UTSW 3 97205473 missense probably damaging 1.00
R0644:Bcl9 UTSW 3 97210497 missense probably benign
R1342:Bcl9 UTSW 3 97205726 missense possibly damaging 0.93
R1836:Bcl9 UTSW 3 97205870 missense probably damaging 0.97
R1886:Bcl9 UTSW 3 97215397 missense probably benign 0.04
R1931:Bcl9 UTSW 3 97205144 missense probably damaging 0.97
R1972:Bcl9 UTSW 3 97207202 missense probably damaging 1.00
R1984:Bcl9 UTSW 3 97213734 missense probably damaging 0.98
R2119:Bcl9 UTSW 3 97208915 missense probably benign 0.04
R3081:Bcl9 UTSW 3 97205673 missense possibly damaging 0.82
R3851:Bcl9 UTSW 3 97209653 missense probably damaging 0.99
R4182:Bcl9 UTSW 3 97213683 critical splice donor site probably null
R4196:Bcl9 UTSW 3 97216368 utr 5 prime probably benign
R4209:Bcl9 UTSW 3 97209953 missense probably damaging 1.00
R5082:Bcl9 UTSW 3 97209902 missense probably damaging 0.97
R5440:Bcl9 UTSW 3 97210565 missense probably benign
R5770:Bcl9 UTSW 3 97215175 missense probably benign
R5863:Bcl9 UTSW 3 97210350 missense probably benign
R5891:Bcl9 UTSW 3 97208888 missense probably damaging 1.00
R6086:Bcl9 UTSW 3 97205524 missense possibly damaging 0.73
R6305:Bcl9 UTSW 3 97205938 missense possibly damaging 0.73
R6626:Bcl9 UTSW 3 97215396 missense probably benign 0.00
R7198:Bcl9 UTSW 3 97205195 missense possibly damaging 0.87
R7198:Bcl9 UTSW 3 97208867 missense probably damaging 0.99
R7548:Bcl9 UTSW 3 97205893 missense probably damaging 1.00
R7897:Bcl9 UTSW 3 97205251 missense possibly damaging 0.92
R8299:Bcl9 UTSW 3 97205536 missense probably damaging 0.97
R8332:Bcl9 UTSW 3 97209770 missense possibly damaging 0.74
R8519:Bcl9 UTSW 3 97209018 missense probably benign
X0011:Bcl9 UTSW 3 97205974 missense probably benign 0.05
Z1088:Bcl9 UTSW 3 97210641 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCCAGGAGGGAAATTTCGAC -3'
(R):5'- AAGCTGCAGCAGGAGTTTTATG -3'

Sequencing Primer
(F):5'- GACCATCTGGGATTTTTGGCACATC -3'
(R):5'- CTGCAGCAGGAGTTTTATGAAGAG -3'
Posted On2014-12-29