Incidental Mutation 'R2924:Kcnd3'
ID255655
Institutional Source Beutler Lab
Gene Symbol Kcnd3
Ensembl Gene ENSMUSG00000040896
Gene Namepotassium voltage-gated channel, Shal-related family, member 3
SynonymsKv4.3, potassium channel Kv4.3M, potassium channel Kv4.3L
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105452330-105674002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105658766 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 421 (A421V)
Ref Sequence ENSEMBL: ENSMUSP00000113436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079169] [ENSMUST00000098761] [ENSMUST00000118360]
Predicted Effect probably damaging
Transcript: ENSMUST00000079169
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078169
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098761
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096357
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 7.3e-19 PFAM
BTB 40 139 1.76e-16 SMART
transmembrane domain 180 202 N/A INTRINSIC
Pfam:Ion_trans 228 402 1e-31 PFAM
Pfam:Ion_trans_2 327 408 8.4e-15 PFAM
low complexity region 412 431 N/A INTRINSIC
Pfam:DUF3399 442 545 9.5e-52 PFAM
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118360
AA Change: A421V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113436
Gene: ENSMUSG00000040896
AA Change: A421V

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.2e-17 PFAM
BTB 40 139 1.76e-16 SMART
Pfam:Ion_trans 182 414 6.6e-45 PFAM
Pfam:Ion_trans_2 327 408 9.5e-15 PFAM
Pfam:DUF3399 442 563 4.7e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141694
Meta Mutation Damage Score 0.1470 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile and exhibit normal cardiac morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Kcnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02296:Kcnd3 APN 3 105667001 nonsense probably null
PIT4498001:Kcnd3 UTSW 3 105658709 missense probably damaging 0.99
R0483:Kcnd3 UTSW 3 105459626 missense probably damaging 1.00
R0544:Kcnd3 UTSW 3 105658759 missense probably damaging 1.00
R1457:Kcnd3 UTSW 3 105668186 missense probably benign 0.00
R1853:Kcnd3 UTSW 3 105459752 missense probably damaging 1.00
R2030:Kcnd3 UTSW 3 105459537 missense probably damaging 1.00
R2077:Kcnd3 UTSW 3 105666999 missense probably benign 0.16
R2106:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2287:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2288:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2316:Kcnd3 UTSW 3 105669126 missense probably benign 0.17
R2909:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R2925:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3014:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3016:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3038:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3696:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3697:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3698:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3777:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3778:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3785:Kcnd3 UTSW 3 105668225 missense possibly damaging 0.79
R3810:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3811:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3815:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3816:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3819:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3877:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3879:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R3899:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4300:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4367:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4370:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4491:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4549:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4550:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4569:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4571:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4593:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4594:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4595:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4624:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4625:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4627:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4630:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4631:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4632:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4799:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R4822:Kcnd3 UTSW 3 105658766 missense probably damaging 1.00
R5021:Kcnd3 UTSW 3 105658754 missense probably damaging 1.00
R5056:Kcnd3 UTSW 3 105666928 intron probably benign
R5849:Kcnd3 UTSW 3 105458795 utr 5 prime probably benign
R7198:Kcnd3 UTSW 3 105459540 missense probably damaging 1.00
R7224:Kcnd3 UTSW 3 105669084 missense probably damaging 0.98
R7532:Kcnd3 UTSW 3 105668210 missense probably damaging 1.00
R7578:Kcnd3 UTSW 3 105459617 missense probably benign 0.08
R7975:Kcnd3 UTSW 3 105458994 missense probably damaging 1.00
R8022:Kcnd3 UTSW 3 105458873 missense probably benign 0.19
Z1177:Kcnd3 UTSW 3 105459570 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGAAGCCCCACTTGTTTCC -3'
(R):5'- AGGCTAACTGAGGACATTGGTG -3'

Sequencing Primer
(F):5'- ACTTGTTTCCCACATGGCC -3'
(R):5'- CTAACTGAGGACATTGGTGGGTAG -3'
Posted On2014-12-29