Mutagenetix > Incidental Mutations

Incidental Mutation 'R2924:Slc24a2'

255656

Institutional Source

Beutler Lab

Gene Symbol

Slc24a2

Ensembl Gene

ENSMUSG00000037996

Gene Name

solute carrier family 24 (sodium/potassium/calcium exchanger), member 2

Synonyms

6330417K15Rik

MMRRC Submission

040509-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R2924 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86983124-87230477 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87011724 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 512 (S512P)

Ref Sequence

ENSEMBL: ENSMUSP00000102776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]

Predicted Effect

probably benign
Transcript: ENSMUST00000044990
AA Change: S463P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: S463P

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	149	281	3.7e-34	PFAM
low complexity region	445	457	N/A	INTRINSIC
transmembrane domain	472	489	N/A	INTRINSIC
Pfam:Na_Ca_ex	509	648	8.9e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107155
AA Change: S446P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: S446P

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	149	281	3.6e-34	PFAM
low complexity region	428	440	N/A	INTRINSIC
transmembrane domain	455	472	N/A	INTRINSIC
Pfam:Na_Ca_ex	492	631	8.5e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107157
AA Change: S467P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: S467P

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	139	283	7.2e-32	PFAM
transmembrane domain	476	493	N/A	INTRINSIC
Pfam:Na_Ca_ex	503	654	4.4e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107158
AA Change: S512P

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: S512P

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC
Pfam:Na_Ca_ex	139	283	8e-32	PFAM
transmembrane domain	521	538	N/A	INTRINSIC
Pfam:Na_Ca_ex	548	699	4.9e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140780

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl9	A	G	3: 97,209,753	S542P	probably benign	Het
Cass4	A	G	2: 172,426,672	R225G	possibly damaging	Het
Ddx50	A	T	10: 62,627,594	V440E	probably damaging	Het
Dmrtc2	G	A	7: 24,872,516	C12Y	probably damaging	Het
Dock6	A	T	9: 21,809,630	I1693N	probably damaging	Het
Fuom	T	C	7: 140,099,949	T110A	probably benign	Het
Gli2	C	T	1: 118,836,359	R1354H	probably benign	Het
Gm5478	A	T	15: 101,643,794		probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Il2rb	T	C	15: 78,491,849	M1V	probably null	Het
Ints6l	A	G	X: 56,504,836	E483G	probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Man2b2	A	G	5: 36,824,102	F224L	probably benign	Het
Mrgpra1	G	A	7: 47,334,870		probably null	Het
Mtbp	G	A	15: 55,619,814	R429Q	probably benign	Het
Ncapg2	C	A	12: 116,438,729	T727K	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Nup214	A	G	2: 31,998,003	K15E	probably damaging	Het
Olfr394	A	G	11: 73,887,511	I287T	probably damaging	Het
Oxr1	T	C	15: 41,825,957	Y526H	probably benign	Het
Plec	A	G	15: 76,178,252	F2563S	probably damaging	Het
Prex2	A	G	1: 11,098,487	T236A	probably damaging	Het
Rbbp5	G	C	1: 132,492,663		probably null	Het
Srd5a1	A	G	13: 69,586,715	S191P	probably damaging	Het
Syt3	T	A	7: 44,395,798	V518E	probably damaging	Het
Tmem132e	T	C	11: 82,444,323	S652P	probably damaging	Het
Uba6	A	T	5: 86,159,271	V102D	probably damaging	Het
Unc13a	A	G	8: 71,644,952	V1158A	possibly damaging	Het
Upk3a	A	G	15: 85,018,149	Y59C	probably benign	Het
Zc3hav1	T	C	6: 38,354,110	Y38C	probably damaging	Het
Zfp119a	C	A	17: 55,868,343	D51Y	possibly damaging	Het

Other mutations in Slc24a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01987:Slc24a2	APN	4	87227796	missense	probably benign	0.01
IGL02080:Slc24a2	APN	4	87227146	missense	probably damaging	1.00
IGL03121:Slc24a2	APN	4	87226906	missense	probably benign	0.00
PIT4403001:Slc24a2	UTSW	4	87032286	missense	probably benign	0.45
R0024:Slc24a2	UTSW	4	87028240	unclassified	probably benign
R0024:Slc24a2	UTSW	4	87028240	unclassified	probably benign
R0372:Slc24a2	UTSW	4	87227292	missense	probably damaging	1.00
R1034:Slc24a2	UTSW	4	87032275	missense	probably damaging	0.99
R1577:Slc24a2	UTSW	4	86991411	missense	probably damaging	1.00
R1776:Slc24a2	UTSW	4	87176289	missense	probably benign	0.01
R1955:Slc24a2	UTSW	4	87073244	missense	probably damaging	1.00
R2043:Slc24a2	UTSW	4	86996645	missense	probably damaging	1.00
R2091:Slc24a2	UTSW	4	87011646	missense	probably damaging	1.00
R2114:Slc24a2	UTSW	4	86991355	missense	probably benign	0.07
R2921:Slc24a2	UTSW	4	86991354	missense	possibly damaging	0.46
R2922:Slc24a2	UTSW	4	86991354	missense	possibly damaging	0.46
R3806:Slc24a2	UTSW	4	87227784	missense	possibly damaging	0.92
R3933:Slc24a2	UTSW	4	87176185	missense	probably benign
R4052:Slc24a2	UTSW	4	87227205	missense	probably damaging	1.00
R4207:Slc24a2	UTSW	4	87227205	missense	probably damaging	1.00
R4466:Slc24a2	UTSW	4	87227862	utr 5 prime	probably benign
R4531:Slc24a2	UTSW	4	86991478	missense	possibly damaging	0.91
R4561:Slc24a2	UTSW	4	87227397	missense	probably damaging	1.00
R4808:Slc24a2	UTSW	4	87032238	missense	probably benign	0.01
R4884:Slc24a2	UTSW	4	86991508	missense	probably damaging	0.98
R4893:Slc24a2	UTSW	4	87226908	missense	probably damaging	0.98
R4936:Slc24a2	UTSW	4	87227347	missense	probably damaging	1.00
R5035:Slc24a2	UTSW	4	87011706	missense	possibly damaging	0.48
R5171:Slc24a2	UTSW	4	86996634	missense	probably benign	0.40
R5369:Slc24a2	UTSW	4	86991388	missense	probably damaging	0.99
R5924:Slc24a2	UTSW	4	87011588	splice site	probably null
R6046:Slc24a2	UTSW	4	86996645	missense	probably damaging	1.00
R6725:Slc24a2	UTSW	4	87226882	critical splice donor site	probably null
R6756:Slc24a2	UTSW	4	87176292	missense	probably benign
R7087:Slc24a2	UTSW	4	86991219	splice site	probably null
R7804:Slc24a2	UTSW	4	86991537	missense	probably damaging	1.00
R8003:Slc24a2	UTSW	4	87176315	missense	probably benign	0.04
R8058:Slc24a2	UTSW	4	86991513	missense	probably damaging	1.00
R8428:Slc24a2	UTSW	4	87227100	missense	probably damaging	1.00
R8529:Slc24a2	UTSW	4	87028280	missense	possibly damaging	0.51
X0003:Slc24a2	UTSW	4	86991447	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTTACATGCATGTCACCTCAC -3'
(R):5'- AGATGGGGTGCTCTTACAAAAG -3'

Sequencing Primer
(F):5'- ACCTTTCTCTTTAAACACAACTGG -3'
(R):5'- GGTGCTCTTACAAAAGAAAGCCCATG -3'

Posted On

2014-12-29