Incidental Mutation 'R2924:Slc24a2'
ID255656
Institutional Source Beutler Lab
Gene Symbol Slc24a2
Ensembl Gene ENSMUSG00000037996
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 2
Synonyms6330417K15Rik
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86983124-87230477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87011724 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 512 (S512P)
Ref Sequence ENSEMBL: ENSMUSP00000102776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044990] [ENSMUST00000107155] [ENSMUST00000107157] [ENSMUST00000107158]
Predicted Effect probably benign
Transcript: ENSMUST00000044990
AA Change: S463P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043937
Gene: ENSMUSG00000037996
AA Change: S463P

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.7e-34 PFAM
low complexity region 445 457 N/A INTRINSIC
transmembrane domain 472 489 N/A INTRINSIC
Pfam:Na_Ca_ex 509 648 8.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107155
AA Change: S446P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102773
Gene: ENSMUSG00000037996
AA Change: S446P

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 149 281 3.6e-34 PFAM
low complexity region 428 440 N/A INTRINSIC
transmembrane domain 455 472 N/A INTRINSIC
Pfam:Na_Ca_ex 492 631 8.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107157
AA Change: S467P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102775
Gene: ENSMUSG00000037996
AA Change: S467P

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 7.2e-32 PFAM
transmembrane domain 476 493 N/A INTRINSIC
Pfam:Na_Ca_ex 503 654 4.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107158
AA Change: S512P

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102776
Gene: ENSMUSG00000037996
AA Change: S512P

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Pfam:Na_Ca_ex 139 283 8e-32 PFAM
transmembrane domain 521 538 N/A INTRINSIC
Pfam:Na_Ca_ex 548 699 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140780
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium/cation antiporter superfamily of transport proteins. The encoded protein belongs to the SLC24 branch of exchangers, which can mediate the extrusion of one Ca2+ ion and one K+ ion in exchange for four Na+ ions. This family member is a retinal cone/brain exchanger that can mediate a light-induced decrease in free Ca2+ concentration. This protein may also play a neuroprotective role during ischemic brain injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in loss of long term potentiation and an increase in long term depression and deficits in motor learning and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Slc24a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc24a2 APN 4 87227796 missense probably benign 0.01
IGL02080:Slc24a2 APN 4 87227146 missense probably damaging 1.00
IGL03121:Slc24a2 APN 4 87226906 missense probably benign 0.00
PIT4403001:Slc24a2 UTSW 4 87032286 missense probably benign 0.45
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0024:Slc24a2 UTSW 4 87028240 unclassified probably benign
R0372:Slc24a2 UTSW 4 87227292 missense probably damaging 1.00
R1034:Slc24a2 UTSW 4 87032275 missense probably damaging 0.99
R1577:Slc24a2 UTSW 4 86991411 missense probably damaging 1.00
R1776:Slc24a2 UTSW 4 87176289 missense probably benign 0.01
R1955:Slc24a2 UTSW 4 87073244 missense probably damaging 1.00
R2043:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R2091:Slc24a2 UTSW 4 87011646 missense probably damaging 1.00
R2114:Slc24a2 UTSW 4 86991355 missense probably benign 0.07
R2921:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R2922:Slc24a2 UTSW 4 86991354 missense possibly damaging 0.46
R3806:Slc24a2 UTSW 4 87227784 missense possibly damaging 0.92
R3933:Slc24a2 UTSW 4 87176185 missense probably benign
R4052:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4207:Slc24a2 UTSW 4 87227205 missense probably damaging 1.00
R4466:Slc24a2 UTSW 4 87227862 utr 5 prime probably benign
R4531:Slc24a2 UTSW 4 86991478 missense possibly damaging 0.91
R4561:Slc24a2 UTSW 4 87227397 missense probably damaging 1.00
R4808:Slc24a2 UTSW 4 87032238 missense probably benign 0.01
R4884:Slc24a2 UTSW 4 86991508 missense probably damaging 0.98
R4893:Slc24a2 UTSW 4 87226908 missense probably damaging 0.98
R4936:Slc24a2 UTSW 4 87227347 missense probably damaging 1.00
R5035:Slc24a2 UTSW 4 87011706 missense possibly damaging 0.48
R5171:Slc24a2 UTSW 4 86996634 missense probably benign 0.40
R5369:Slc24a2 UTSW 4 86991388 missense probably damaging 0.99
R5924:Slc24a2 UTSW 4 87011588 splice site probably null
R6046:Slc24a2 UTSW 4 86996645 missense probably damaging 1.00
R6725:Slc24a2 UTSW 4 87226882 critical splice donor site probably null
R6756:Slc24a2 UTSW 4 87176292 missense probably benign
R7087:Slc24a2 UTSW 4 86991219 splice site probably null
R7804:Slc24a2 UTSW 4 86991537 missense probably damaging 1.00
R8003:Slc24a2 UTSW 4 87176315 missense probably benign 0.04
R8058:Slc24a2 UTSW 4 86991513 missense probably damaging 1.00
R8428:Slc24a2 UTSW 4 87227100 missense probably damaging 1.00
R8529:Slc24a2 UTSW 4 87028280 missense possibly damaging 0.51
X0003:Slc24a2 UTSW 4 86991447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTACATGCATGTCACCTCAC -3'
(R):5'- AGATGGGGTGCTCTTACAAAAG -3'

Sequencing Primer
(F):5'- ACCTTTCTCTTTAAACACAACTGG -3'
(R):5'- GGTGCTCTTACAAAAGAAAGCCCATG -3'
Posted On2014-12-29