Incidental Mutation 'R2924:Man2b2'
ID255657
Institutional Source Beutler Lab
Gene Symbol Man2b2
Ensembl Gene ENSMUSG00000029119
Gene Namemannosidase 2, alpha B2
Synonyms135 kDa alpha-D-mannosidase
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36806921-36830653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36824102 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 224 (F224L)
Ref Sequence ENSEMBL: ENSMUSP00000031002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031002]
Predicted Effect probably benign
Transcript: ENSMUST00000031002
AA Change: F224L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000031002
Gene: ENSMUSG00000029119
AA Change: F224L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_38 28 351 4e-100 PFAM
Alpha-mann_mid 356 439 3.3e-20 SMART
Pfam:Glyco_hydro_38C 487 1013 2e-98 PFAM
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Man2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Man2b2 APN 5 36816143 nonsense probably null
IGL01098:Man2b2 APN 5 36815556 missense probably damaging 1.00
IGL01367:Man2b2 APN 5 36814337 nonsense probably null
IGL01781:Man2b2 APN 5 36813745 missense possibly damaging 0.80
IGL01809:Man2b2 APN 5 36814516 missense probably benign 0.01
IGL02824:Man2b2 APN 5 36821851 missense probably benign 0.09
IGL03323:Man2b2 APN 5 36818514 missense probably benign 0.07
IGL03333:Man2b2 APN 5 36816139 missense probably damaging 0.96
R0505:Man2b2 UTSW 5 36816198 missense probably benign 0.00
R0715:Man2b2 UTSW 5 36826058 missense probably benign 0.00
R1435:Man2b2 UTSW 5 36813067 missense probably damaging 0.98
R1536:Man2b2 UTSW 5 36820927 missense probably benign 0.10
R1944:Man2b2 UTSW 5 36816180 missense probably benign
R2079:Man2b2 UTSW 5 36814372 missense possibly damaging 0.64
R2475:Man2b2 UTSW 5 36807875 missense probably benign 0.01
R2925:Man2b2 UTSW 5 36824102 missense probably benign 0.01
R2938:Man2b2 UTSW 5 36820986 missense probably benign 0.27
R3777:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3778:Man2b2 UTSW 5 36815527 missense probably benign 0.00
R3982:Man2b2 UTSW 5 36813820 missense probably benign 0.10
R4618:Man2b2 UTSW 5 36817639 missense probably benign 0.06
R4822:Man2b2 UTSW 5 36815521 missense probably damaging 1.00
R5320:Man2b2 UTSW 5 36810333 missense probably damaging 1.00
R5394:Man2b2 UTSW 5 36814518 missense probably benign 0.03
R5468:Man2b2 UTSW 5 36807175 missense probably benign 0.00
R5993:Man2b2 UTSW 5 36820980 missense probably benign 0.12
R6053:Man2b2 UTSW 5 36813038 missense probably benign 0.00
R6083:Man2b2 UTSW 5 36809041 missense probably damaging 1.00
R6376:Man2b2 UTSW 5 36821034 missense probably damaging 1.00
R6669:Man2b2 UTSW 5 36810358 missense probably benign 0.00
R7000:Man2b2 UTSW 5 36821869 missense probably damaging 1.00
R7108:Man2b2 UTSW 5 36815485 missense probably benign 0.04
R7376:Man2b2 UTSW 5 36813378 missense probably damaging 1.00
R7478:Man2b2 UTSW 5 36810313 missense probably damaging 1.00
R7712:Man2b2 UTSW 5 36810314 missense probably benign 0.00
R8059:Man2b2 UTSW 5 36816160 missense probably damaging 1.00
X0022:Man2b2 UTSW 5 36813892 missense probably damaging 0.99
Z1088:Man2b2 UTSW 5 36815356 missense possibly damaging 0.46
Z1177:Man2b2 UTSW 5 36813797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGGTTCTATGAGCACC -3'
(R):5'- CCTTTGAAAGAGGCTGAAGGTG -3'

Sequencing Primer
(F):5'- GTTCTATGAGCACCCCGTG -3'
(R):5'- GCATGCGCAATGGACTTG -3'
Posted On2014-12-29