Incidental Mutation 'R2924:Dmrtc2'
ID255661
Institutional Source Beutler Lab
Gene Symbol Dmrtc2
Ensembl Gene ENSMUSG00000011349
Gene Namedoublesex and mab-3 related transcription factor like family C2
SynonymsDmrt7, 4933432E21Rik
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24870057-24877651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24872516 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 12 (C12Y)
Ref Sequence ENSEMBL: ENSMUSP00000011493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011493] [ENSMUST00000079306] [ENSMUST00000122995]
Predicted Effect probably damaging
Transcript: ENSMUST00000011493
AA Change: C12Y

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000011493
Gene: ENSMUSG00000011349
AA Change: C12Y

DomainStartEndE-ValueType
DM 38 91 6.53e-21 SMART
low complexity region 163 189 N/A INTRINSIC
Pfam:DMRT-like 242 369 3.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079306
SMART Domains Protein: ENSMUSP00000078287
Gene: ENSMUSG00000062732

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPAR_LY6 142 233 7.5e-23 PFAM
low complexity region 237 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122995
SMART Domains Protein: ENSMUSP00000122913
Gene: ENSMUSG00000062732

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Males homozygous for a targeted allele are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Dmrtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dmrtc2 APN 7 24872576 missense probably damaging 1.00
IGL02122:Dmrtc2 APN 7 24872583 missense possibly damaging 0.71
IGL02469:Dmrtc2 APN 7 24872713 unclassified probably benign
R1173:Dmrtc2 UTSW 7 24874313 missense possibly damaging 0.94
R1775:Dmrtc2 UTSW 7 24874367 missense possibly damaging 0.57
R2167:Dmrtc2 UTSW 7 24873919 unclassified probably benign
R3685:Dmrtc2 UTSW 7 24874262 missense probably benign
R4205:Dmrtc2 UTSW 7 24875806 nonsense probably null
R5455:Dmrtc2 UTSW 7 24872491 missense probably benign 0.04
Z31818:Dmrtc2 UTSW 7 24877158 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACCCGAGCATGGCAAAGC -3'
(R):5'- CACTCGCAAGCCTGAAAGAG -3'

Sequencing Primer
(F):5'- GAAGGATCTTAGTGTCGAATGAATAC -3'
(R):5'- AGGCAGAGGCGCTTGTGTC -3'
Posted On2014-12-29