Incidental Mutation 'R2924:Fuom'
ID255664
Institutional Source Beutler Lab
Gene Symbol Fuom
Ensembl Gene ENSMUSG00000025466
Gene Namefucose mutarotase
Synonyms1810014F10Rik
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140096770-140102441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140099949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 110 (T110A)
Ref Sequence ENSEMBL: ENSMUSP00000120353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026539] [ENSMUST00000026540] [ENSMUST00000120034] [ENSMUST00000121115] [ENSMUST00000142105] [ENSMUST00000148716]
Predicted Effect probably benign
Transcript: ENSMUST00000026539
AA Change: T110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026539
Gene: ENSMUSG00000025466
AA Change: T110A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 148 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026540
SMART Domains Protein: ENSMUSP00000026540
Gene: ENSMUSG00000025467

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:PRAP 100 144 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120034
AA Change: T110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112429
Gene: ENSMUSG00000025466
AA Change: T110A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 134 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121115
SMART Domains Protein: ENSMUSP00000112970
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 117 9.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125421
Predicted Effect probably benign
Transcript: ENSMUST00000128527
SMART Domains Protein: ENSMUSP00000118717
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 1 105 4.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138197
Predicted Effect probably benign
Transcript: ENSMUST00000142105
AA Change: T105A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115799
Gene: ENSMUSG00000025466
AA Change: T105A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 1 134 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147713
Predicted Effect probably benign
Transcript: ENSMUST00000148716
AA Change: T110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120353
Gene: ENSMUSG00000025466
AA Change: T110A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 133 7.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155777
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit reduced female sexual receptivity and masculinized sexual behaviors in female mice. Heterozygous mice exhibit intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Fuom
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1248:Fuom UTSW 7 140099718 splice site probably benign
R1938:Fuom UTSW 7 140099608 missense probably benign 0.01
R2925:Fuom UTSW 7 140099949 missense probably benign
R4722:Fuom UTSW 7 140099567 unclassified probably benign
R5542:Fuom UTSW 7 140100112 makesense probably null
R5958:Fuom UTSW 7 140099898 missense probably damaging 1.00
R7392:Fuom UTSW 7 140101160 missense probably damaging 1.00
R7734:Fuom UTSW 7 140099542 missense unknown
R7892:Fuom UTSW 7 140099579 missense unknown
R8026:Fuom UTSW 7 140100154 missense
Predicted Primers PCR Primer
(F):5'- CTGGGACTCCAACTTTGCTC -3'
(R):5'- GTCTCTGGATCCTTGAAACTCC -3'

Sequencing Primer
(F):5'- GGGACTCCAACTTTGCTCTCAGAG -3'
(R):5'- TGGATCCTTGAAACTCCAGCATCAG -3'
Posted On2014-12-29