Mutagenetix > Incidental Mutations

Incidental Mutation 'R2924:Unc13a'

255665

Institutional Source

Beutler Lab

Gene Symbol

Unc13a

Ensembl Gene

ENSMUSG00000034799

Gene Name

unc-13 homolog A (C. elegans)

Synonyms

2410078G03Rik, Munc13-1

MMRRC Submission

040509-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2924 (G1)

Quality Score

183

Status

Not validated

Chromosome

Chromosomal Location

71624417-71671757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71644952 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1158 (V1158A)

Ref Sequence

ENSEMBL: ENSMUSP00000030170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030170
AA Change: V1158A

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: V1158A

Domain	Start	End	E-Value	Type
C2	3	94	5.23e-10	SMART
low complexity region	187	202	N/A	INTRINSIC
low complexity region	264	277	N/A	INTRINSIC
low complexity region	299	310	N/A	INTRINSIC
coiled coil region	321	359	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	435	450	N/A	INTRINSIC
PDB:2KDU\|B	454	488	3e-16	PDB
C1	563	612	3.93e-18	SMART
C2	686	793	5.86e-22	SMART
DUF1041	1002	1111	1.6e-56	SMART
Pfam:Membr_traf_MHD	1355	1520	6.3e-53	PFAM
C2	1555	1661	5.03e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175909

Predicted Effect

unknown
Transcript: ENSMUST00000176127
AA Change: V67A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177032

Predicted Effect

probably benign
Transcript: ENSMUST00000177517
AA Change: V1158A

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: V1158A

Domain	Start	End	E-Value	Type
C2	3	94	5.23e-10	SMART
low complexity region	187	202	N/A	INTRINSIC
low complexity region	264	277	N/A	INTRINSIC
low complexity region	299	310	N/A	INTRINSIC
coiled coil region	321	359	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	435	450	N/A	INTRINSIC
PDB:2KDU\|B	454	488	3e-16	PDB
C1	563	612	3.93e-18	SMART
C2	686	793	5.86e-22	SMART
DUF1041	1002	1111	1.6e-56	SMART
Pfam:Membr_traf_MHD	1355	1520	6.7e-53	PFAM
C2	1574	1680	5.03e-12	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl9	A	G	3: 97,209,753	S542P	probably benign	Het
Cass4	A	G	2: 172,426,672	R225G	possibly damaging	Het
Ddx50	A	T	10: 62,627,594	V440E	probably damaging	Het
Dmrtc2	G	A	7: 24,872,516	C12Y	probably damaging	Het
Dock6	A	T	9: 21,809,630	I1693N	probably damaging	Het
Fuom	T	C	7: 140,099,949	T110A	probably benign	Het
Gli2	C	T	1: 118,836,359	R1354H	probably benign	Het
Gm5478	A	T	15: 101,643,794		probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Il2rb	T	C	15: 78,491,849	M1V	probably null	Het
Ints6l	A	G	X: 56,504,836	E483G	probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Man2b2	A	G	5: 36,824,102	F224L	probably benign	Het
Mrgpra1	G	A	7: 47,334,870		probably null	Het
Mtbp	G	A	15: 55,619,814	R429Q	probably benign	Het
Ncapg2	C	A	12: 116,438,729	T727K	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Nup214	A	G	2: 31,998,003	K15E	probably damaging	Het
Olfr394	A	G	11: 73,887,511	I287T	probably damaging	Het
Oxr1	T	C	15: 41,825,957	Y526H	probably benign	Het
Plec	A	G	15: 76,178,252	F2563S	probably damaging	Het
Prex2	A	G	1: 11,098,487	T236A	probably damaging	Het
Rbbp5	G	C	1: 132,492,663		probably null	Het
Slc24a2	A	G	4: 87,011,724	S512P	probably benign	Het
Srd5a1	A	G	13: 69,586,715	S191P	probably damaging	Het
Syt3	T	A	7: 44,395,798	V518E	probably damaging	Het
Tmem132e	T	C	11: 82,444,323	S652P	probably damaging	Het
Uba6	A	T	5: 86,159,271	V102D	probably damaging	Het
Upk3a	A	G	15: 85,018,149	Y59C	probably benign	Het
Zc3hav1	T	C	6: 38,354,110	Y38C	probably damaging	Het
Zfp119a	C	A	17: 55,868,343	D51Y	possibly damaging	Het

Other mutations in Unc13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Unc13a	APN	8	71643147	missense	probably null	0.70
IGL01023:Unc13a	APN	8	71661825	missense	probably benign	0.02
IGL01456:Unc13a	APN	8	71644567	missense	probably damaging	1.00
IGL01820:Unc13a	APN	8	71654947	missense	probably damaging	0.99
IGL01909:Unc13a	APN	8	71639210	splice site	probably benign
IGL01925:Unc13a	APN	8	71634543	missense	possibly damaging	0.95
IGL02407:Unc13a	APN	8	71648942	missense	probably damaging	0.99
IGL02622:Unc13a	APN	8	71652514	splice site	probably null
IGL02634:Unc13a	APN	8	71655701	missense	probably benign	0.03
IGL02724:Unc13a	APN	8	71656305	splice site	probably benign
IGL02892:Unc13a	APN	8	71649910	missense	probably damaging	1.00
IGL02948:Unc13a	APN	8	71650549	missense	possibly damaging	0.63
IGL03081:Unc13a	APN	8	71649549	missense	probably damaging	0.98
IGL03372:Unc13a	APN	8	71655709	missense	probably damaging	1.00
curvy	UTSW	8	71630504	splice site	probably null
Greed	UTSW	8	71654845	missense	probably damaging	1.00
largesse	UTSW	8	71634658	missense	probably damaging	1.00
serpiginous	UTSW	8	71664245	missense	probably damaging	1.00
PIT4469001:Unc13a	UTSW	8	71658314	nonsense	probably null
R0067:Unc13a	UTSW	8	71634658	missense	probably damaging	1.00
R0067:Unc13a	UTSW	8	71634658	missense	probably damaging	1.00
R0389:Unc13a	UTSW	8	71658032	missense	probably benign	0.01
R0457:Unc13a	UTSW	8	71658001	critical splice donor site	probably null
R0478:Unc13a	UTSW	8	71651148	missense	possibly damaging	0.92
R0483:Unc13a	UTSW	8	71644913	missense	probably damaging	0.96
R0609:Unc13a	UTSW	8	71658467	missense	probably damaging	0.96
R0611:Unc13a	UTSW	8	71649865	missense	probably damaging	1.00
R0730:Unc13a	UTSW	8	71656285	missense	possibly damaging	0.68
R0883:Unc13a	UTSW	8	71642173	nonsense	probably null
R1162:Unc13a	UTSW	8	71647917	missense	probably benign	0.31
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1196:Unc13a	UTSW	8	71654986	missense	probably damaging	1.00
R1400:Unc13a	UTSW	8	71651221	missense	probably damaging	1.00
R1446:Unc13a	UTSW	8	71648981	missense	possibly damaging	0.91
R1507:Unc13a	UTSW	8	71658266	missense	probably benign
R1636:Unc13a	UTSW	8	71653390	missense	probably damaging	1.00
R1858:Unc13a	UTSW	8	71652399	missense	probably damaging	1.00
R2025:Unc13a	UTSW	8	71639768	missense	possibly damaging	0.92
R2107:Unc13a	UTSW	8	71656251	splice site	probably null
R2286:Unc13a	UTSW	8	71630559	missense	probably damaging	1.00
R2334:Unc13a	UTSW	8	71634558	missense	probably damaging	1.00
R3177:Unc13a	UTSW	8	71629695	missense	probably benign	0.01
R3277:Unc13a	UTSW	8	71629695	missense	probably benign	0.01
R4175:Unc13a	UTSW	8	71667724	intron	probably benign
R4279:Unc13a	UTSW	8	71666667	missense	probably damaging	0.98
R4629:Unc13a	UTSW	8	71653453	missense	possibly damaging	0.65
R4803:Unc13a	UTSW	8	71662850	splice site	probably null
R4877:Unc13a	UTSW	8	71658616	missense	possibly damaging	0.85
R4927:Unc13a	UTSW	8	71654845	missense	probably damaging	1.00
R4930:Unc13a	UTSW	8	71630504	splice site	probably null
R4994:Unc13a	UTSW	8	71643172	missense	probably benign	0.28
R5011:Unc13a	UTSW	8	71641477	nonsense	probably null
R5252:Unc13a	UTSW	8	71652564	missense	probably damaging	1.00
R5356:Unc13a	UTSW	8	71662514	missense	probably benign	0.02
R5458:Unc13a	UTSW	8	71664245	missense	probably damaging	1.00
R5514:Unc13a	UTSW	8	71643151	missense	probably damaging	1.00
R5784:Unc13a	UTSW	8	71655666	missense	possibly damaging	0.61
R5853:Unc13a	UTSW	8	71655129	splice site	probably null
R6183:Unc13a	UTSW	8	71644666	missense	probably damaging	1.00
R6277:Unc13a	UTSW	8	71666639	critical splice donor site	probably null
R6374:Unc13a	UTSW	8	71641453	missense	possibly damaging	0.70
R6392:Unc13a	UTSW	8	71637809	missense	possibly damaging	0.83
R6515:Unc13a	UTSW	8	71647940	missense	probably benign	0.44
R6576:Unc13a	UTSW	8	71653478	missense	probably benign	0.00
R6943:Unc13a	UTSW	8	71652377	missense	probably damaging	1.00
R7045:Unc13a	UTSW	8	71658763	missense	possibly damaging	0.95
R7062:Unc13a	UTSW	8	71663237	missense	probably benign	0.00
R7146:Unc13a	UTSW	8	71630553	missense	probably damaging	1.00
R7260:Unc13a	UTSW	8	71660585	missense	possibly damaging	0.71
R7443:Unc13a	UTSW	8	71630959	missense	probably damaging	0.98
R7545:Unc13a	UTSW	8	71641509	critical splice acceptor site	probably null
R7644:Unc13a	UTSW	8	71634538	missense	probably benign	0.13
R7780:Unc13a	UTSW	8	71658335	missense	probably benign	0.02
R7952:Unc13a	UTSW	8	71658487	missense	possibly damaging	0.71
R7989:Unc13a	UTSW	8	71652273	missense	probably damaging	1.00
R8169:Unc13a	UTSW	8	71656289	missense	probably damaging	1.00
R8503:Unc13a	UTSW	8	71645761	missense	possibly damaging	0.67
R8504:Unc13a	UTSW	8	71645761	missense	possibly damaging	0.67
Z1088:Unc13a	UTSW	8	71654803	critical splice donor site	probably null
Z1177:Unc13a	UTSW	8	71644872	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAGACCATGGCATTGCTCCC -3'
(R):5'- CTGAAGTGACAAATCCATTGGGG -3'

Sequencing Primer
(F):5'- ATGGCATTGCTCCCTGAGG -3'
(R):5'- CATTGGGGATGGAATCTGGGGAC -3'

Posted On

2014-12-29