Incidental Mutation 'R2924:Olfr394'
ID255668
Institutional Source Beutler Lab
Gene Symbol Olfr394
Ensembl Gene ENSMUSG00000056921
Gene Nameolfactory receptor 394
SynonymsMOR135-8, GA_x6K02T2P1NL-4043306-4042374
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73883337-73890771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73887511 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 287 (I287T)
Ref Sequence ENSEMBL: ENSMUSP00000149527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071478] [ENSMUST00000214284] [ENSMUST00000216608]
Predicted Effect probably damaging
Transcript: ENSMUST00000071478
AA Change: I287T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071415
Gene: ENSMUSG00000056921
AA Change: I287T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4e-7 PFAM
Pfam:7tm_1 39 288 1.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214284
AA Change: I287T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216608
AA Change: I287T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Olfr394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr394 APN 11 73888249 missense probably damaging 1.00
IGL01655:Olfr394 APN 11 73887927 missense probably benign 0.01
IGL02173:Olfr394 APN 11 73888123 missense possibly damaging 0.72
IGL02308:Olfr394 APN 11 73888295 missense probably benign 0.09
IGL02656:Olfr394 APN 11 73888039 missense probably damaging 0.98
R0079:Olfr394 UTSW 11 73887737 missense probably benign 0.22
R0119:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0136:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0136:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0255:Olfr394 UTSW 11 73887829 missense probably benign
R0545:Olfr394 UTSW 11 73888017 nonsense probably null
R0599:Olfr394 UTSW 11 73887904 missense probably benign 0.19
R0655:Olfr394 UTSW 11 73887805 missense possibly damaging 0.88
R0657:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0657:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0720:Olfr394 UTSW 11 73887862 missense probably benign 0.12
R1112:Olfr394 UTSW 11 73888234 missense probably damaging 0.99
R2353:Olfr394 UTSW 11 73887834 missense probably benign 0.02
R4583:Olfr394 UTSW 11 73887803 missense probably damaging 1.00
R5231:Olfr394 UTSW 11 73887955 missense probably damaging 1.00
R5537:Olfr394 UTSW 11 73887697 missense probably benign 0.02
R5806:Olfr394 UTSW 11 73887547 missense probably damaging 0.99
R7131:Olfr394 UTSW 11 73887954 nonsense probably null
R7325:Olfr394 UTSW 11 73888275 missense probably benign 0.19
R7361:Olfr394 UTSW 11 73888001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGACTTCCTTGTAGGTC -3'
(R):5'- GGAGGGCTCATCATTGTTATTCC -3'

Sequencing Primer
(F):5'- CATGGACTTCCTTGTAGGTCCTATG -3'
(R):5'- TAAGGTTCCATCTACTCAAGGC -3'
Posted On2014-12-29