Mutagenetix > Incidental Mutations

Incidental Mutation 'R2924:Nsf'

255670

Institutional Source

Beutler Lab

Gene Symbol

Nsf

Ensembl Gene

ENSMUSG00000034187

Gene Name

N-ethylmaleimide sensitive fusion protein

Synonyms

SKD2, N-ethylmaleimide sensitive factor

MMRRC Submission

040509-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2924 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103821782-103954056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 103930752 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 26 (E26K)

Ref Sequence

ENSEMBL: ENSMUSP00000099364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

Domain	Start	End	E-Value	Type
CDC48_N	5	86	2.7e-16	SMART
CDC48_2	111	183	6.22e-7	SMART
AAA	252	399	3.65e-19	SMART
AAA	535	671	2.2e-13	SMART
low complexity region	674	683	N/A	INTRINSIC
low complexity region	698	711	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107009

Predicted Effect

probably benign
Transcript: ENSMUST00000133774

SMART Domains

Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

Domain	Start	End	E-Value	Type
Pfam:CDC48_N	1	51	1.5e-10	PFAM
CDC48_2	76	148	6.22e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140394

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145126

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

Domain	Start	End	E-Value	Type
CDC48_N	2	76	6.51e-10	SMART

Meta Mutation Damage Score

0.0893

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl9	A	G	3: 97,209,753	S542P	probably benign	Het
Cass4	A	G	2: 172,426,672	R225G	possibly damaging	Het
Ddx50	A	T	10: 62,627,594	V440E	probably damaging	Het
Dmrtc2	G	A	7: 24,872,516	C12Y	probably damaging	Het
Dock6	A	T	9: 21,809,630	I1693N	probably damaging	Het
Fuom	T	C	7: 140,099,949	T110A	probably benign	Het
Gli2	C	T	1: 118,836,359	R1354H	probably benign	Het
Gm5478	A	T	15: 101,643,794		probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Il2rb	T	C	15: 78,491,849	M1V	probably null	Het
Ints6l	A	G	X: 56,504,836	E483G	probably benign	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Man2b2	A	G	5: 36,824,102	F224L	probably benign	Het
Mrgpra1	G	A	7: 47,334,870		probably null	Het
Mtbp	G	A	15: 55,619,814	R429Q	probably benign	Het
Ncapg2	C	A	12: 116,438,729	T727K	probably benign	Het
Nup214	A	G	2: 31,998,003	K15E	probably damaging	Het
Olfr394	A	G	11: 73,887,511	I287T	probably damaging	Het
Oxr1	T	C	15: 41,825,957	Y526H	probably benign	Het
Plec	A	G	15: 76,178,252	F2563S	probably damaging	Het
Prex2	A	G	1: 11,098,487	T236A	probably damaging	Het
Rbbp5	G	C	1: 132,492,663		probably null	Het
Slc24a2	A	G	4: 87,011,724	S512P	probably benign	Het
Srd5a1	A	G	13: 69,586,715	S191P	probably damaging	Het
Syt3	T	A	7: 44,395,798	V518E	probably damaging	Het
Tmem132e	T	C	11: 82,444,323	S652P	probably damaging	Het
Uba6	A	T	5: 86,159,271	V102D	probably damaging	Het
Unc13a	A	G	8: 71,644,952	V1158A	possibly damaging	Het
Upk3a	A	G	15: 85,018,149	Y59C	probably benign	Het
Zc3hav1	T	C	6: 38,354,110	Y38C	probably damaging	Het
Zfp119a	C	A	17: 55,868,343	D51Y	possibly damaging	Het

Other mutations in Nsf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Nsf	APN	11	103861885	splice site	probably benign
IGL01377:Nsf	APN	11	103872647	missense	probably damaging	0.97
IGL01994:Nsf	APN	11	103928782	missense	probably damaging	0.98
IGL02141:Nsf	APN	11	103828525	missense	probably benign	0.02
IGL02663:Nsf	APN	11	103930815	missense	probably benign	0.04
IGL02871:Nsf	APN	11	103862056	splice site	probably benign
uhaul	UTSW	11	103930752	missense	possibly damaging	0.59
R0180:Nsf	UTSW	11	103930780	missense	probably damaging	1.00
R0880:Nsf	UTSW	11	103913372	missense	possibly damaging	0.72
R1146:Nsf	UTSW	11	103828538	missense	probably damaging	1.00
R1146:Nsf	UTSW	11	103828538	missense	probably damaging	1.00
R1203:Nsf	UTSW	11	103926126	unclassified	probably benign
R1873:Nsf	UTSW	11	103859017	missense	probably damaging	1.00
R1951:Nsf	UTSW	11	103882876	nonsense	probably null
R2163:Nsf	UTSW	11	103863333	missense	possibly damaging	0.64
R2193:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2194:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2287:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2289:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2343:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2345:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2346:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2347:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2350:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2405:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2406:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2407:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2408:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2409:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2411:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2435:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2925:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R2987:Nsf	UTSW	11	103859043	splice site	probably null
R3177:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R3277:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R3741:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R3742:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R3845:Nsf	UTSW	11	103930752	missense	possibly damaging	0.59
R4278:Nsf	UTSW	11	103930806	missense	probably damaging	0.96
R4717:Nsf	UTSW	11	103823769	missense	probably damaging	1.00
R4775:Nsf	UTSW	11	103872593	missense	possibly damaging	0.93
R4915:Nsf	UTSW	11	103910359	unclassified	probably benign
R4918:Nsf	UTSW	11	103910359	unclassified	probably benign
R5090:Nsf	UTSW	11	103910578	missense	probably benign	0.00
R5126:Nsf	UTSW	11	103882792	nonsense	probably null
R5411:Nsf	UTSW	11	103882811	missense	probably damaging	1.00
R5560:Nsf	UTSW	11	103863255	missense	possibly damaging	0.47
R6344:Nsf	UTSW	11	103861904	missense	probably damaging	1.00
R6596:Nsf	UTSW	11	103910457	missense	probably damaging	0.98
R7155:Nsf	UTSW	11	103828530	nonsense	probably null
R7272:Nsf	UTSW	11	103827238	missense	probably damaging	1.00
R7769:Nsf	UTSW	11	103928839	missense	probably damaging	1.00
R8323:Nsf	UTSW	11	103928839	missense	probably benign	0.05
R8487:Nsf	UTSW	11	103928758	missense	probably damaging	1.00
X0066:Nsf	UTSW	11	103823740	missense	probably benign
Z1176:Nsf	UTSW	11	103910554	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAAGCAAGGTGACTACCAACC -3'
(R):5'- ATGCAGTTGTGTGGTAAGGAAGG -3'

Sequencing Primer
(F):5'- TGTGATACCTATACCCAGTG -3'
(R):5'- AGGGTGCTTTCTTCTAGTGC -3'

Posted On

2014-12-29