Incidental Mutation 'R2924:Ncapg2'
ID255673
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116438729 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 727 (T727K)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
Predicted Effect probably benign
Transcript: ENSMUST00000084828
AA Change: T727K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: T727K

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8132:Ncapg2 UTSW 12 116444347 missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTATGAGGCCTGTGTTTCC -3'
(R):5'- GAGCACGTGTCATTGATTTCC -3'

Sequencing Primer
(F):5'- CCTTGATACAAATTAAGTGGGAGC -3'
(R):5'- CACTTTCCGTTTAGAGGCCAAG -3'
Posted On2014-12-29