Incidental Mutation 'R2924:Upk3a'
ID255679
Institutional Source Beutler Lab
Gene Symbol Upk3a
Ensembl Gene ENSMUSG00000022435
Gene Nameuroplakin 3A
SynonymsUpk3, 1110017C07Rik
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85017141-85022547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85018149 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 59 (Y59C)
Ref Sequence ENSEMBL: ENSMUSP00000023070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023070]
Predicted Effect probably benign
Transcript: ENSMUST00000023070
AA Change: Y59C

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023070
Gene: ENSMUSG00000022435
AA Change: Y59C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230801
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the uroplakin family, a group of transmembrane proteins that form complexes on the apical surface of the bladder epithelium. Mutations in this gene may be associated with renal adysplasia. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit urogenital defects including abnormal urothelium, vesicoureteral reflux, and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Upk3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Upk3a APN 15 85019585 missense probably damaging 1.00
R1298:Upk3a UTSW 15 85020551 missense probably benign 0.04
R1791:Upk3a UTSW 15 85020614 missense possibly damaging 0.91
R2092:Upk3a UTSW 15 85018085 missense probably damaging 0.98
R2925:Upk3a UTSW 15 85018149 missense probably benign 0.17
R3402:Upk3a UTSW 15 85018183 critical splice donor site probably null
R3403:Upk3a UTSW 15 85018183 critical splice donor site probably null
R4574:Upk3a UTSW 15 85020551 missense possibly damaging 0.95
R4896:Upk3a UTSW 15 85019423 missense probably benign 0.00
R5893:Upk3a UTSW 15 85019337 missense probably damaging 1.00
R6239:Upk3a UTSW 15 85021314 missense probably damaging 1.00
R7403:Upk3a UTSW 15 85019508 missense possibly damaging 0.91
R7486:Upk3a UTSW 15 85018024 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTACTGGACCTGCAGCAAG -3'
(R):5'- ACAGTGGCTCTAAAGTGGGC -3'

Sequencing Primer
(F):5'- CAAGGGCCCAGAGGTCAG -3'
(R):5'- AAACTGGTGTGGCTCCCTC -3'
Posted On2014-12-29