Incidental Mutation 'R2924:Gm5478'
ID255680
Institutional Source Beutler Lab
Gene Symbol Gm5478
Ensembl Gene ENSMUSG00000095241
Gene Namepredicted pseudogene 5478
Synonyms
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101643020-101647380 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 101643794 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100184] [ENSMUST00000229963]
Predicted Effect probably null
Transcript: ENSMUST00000100184
SMART Domains Protein: ENSMUSP00000097759
Gene: ENSMUSG00000095241

DomainStartEndE-ValueType
Pfam:Filament 1 114 1.1e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229579
Predicted Effect probably null
Transcript: ENSMUST00000229963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230401
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Oxr1 T C 15: 41,825,957 Y526H probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Gm5478
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03137:Gm5478 APN 15 101644382 missense probably benign 0.00
R0325:Gm5478 UTSW 15 101644326 missense probably damaging 1.00
R0607:Gm5478 UTSW 15 101644624 missense probably damaging 1.00
R1476:Gm5478 UTSW 15 101644645 missense probably damaging 1.00
R1962:Gm5478 UTSW 15 101644395 missense probably damaging 1.00
R3236:Gm5478 UTSW 15 101644303 missense probably damaging 1.00
R4133:Gm5478 UTSW 15 101644645 missense probably damaging 1.00
R5267:Gm5478 UTSW 15 101644402 missense probably damaging 1.00
R5480:Gm5478 UTSW 15 101643665 missense probably damaging 1.00
R5524:Gm5478 UTSW 15 101644667 missense probably benign 0.31
R6959:Gm5478 UTSW 15 101645448 missense probably damaging 0.99
R7035:Gm5478 UTSW 15 101645197 missense possibly damaging 0.84
R8458:Gm5478 UTSW 15 101645427 missense probably benign 0.00
R8461:Gm5478 UTSW 15 101646217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGGACACTGGCATAGG -3'
(R):5'- CCATGGTTACTTCAAGAAACTCC -3'

Sequencing Primer
(F):5'- GCATAGGAATGGCTGCTGC -3'
(R):5'- AAGAAACTCCTTCCTGTGCTGGAG -3'
Posted On2014-12-29