Incidental Mutation 'R2925:AI314180'
ID255698
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission 040510-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R2925 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 58833928 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 851 (K851*)
Ref Sequence ENSEMBL: ENSMUSP00000117585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000149301]
Predicted Effect probably null
Transcript: ENSMUST00000102889
AA Change: K851*
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: K851*

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107557
AA Change: K851*
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: K851*

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142102
Predicted Effect probably null
Transcript: ENSMUST00000149301
AA Change: K851*
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: K851*

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151869
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,298 T93A probably damaging Het
4932438A13Rik G T 3: 37,007,122 A3327S probably damaging Het
9530003J23Rik C T 10: 117,234,431 R147Q probably benign Het
Akr1c21 A G 13: 4,576,350 probably null Het
Alk A G 17: 72,603,207 V168A probably benign Het
Ap4b1 A G 3: 103,820,681 E337G probably damaging Het
Btn2a2 A G 13: 23,481,814 S283P probably damaging Het
Ctcfl C T 2: 173,094,696 E628K probably damaging Het
Cul9 G A 17: 46,510,981 T1856M probably benign Het
Defb41 T C 1: 18,260,633 D30G probably damaging Het
Dnaic1 A T 4: 41,597,919 I74F probably damaging Het
Fbln2 T A 6: 91,265,855 C846S probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gm498 A T 7: 143,883,999 R147* probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nek4 G A 14: 30,951,710 G29S probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr1029 T A 2: 85,975,781 C179* probably null Het
Olfr1079 C T 2: 86,538,547 D121N probably damaging Het
Olfr206 A T 16: 59,345,343 Y119* probably null Het
Olfr460 T A 6: 40,571,408 S7R probably benign Het
P2ry13 G A 3: 59,209,380 H326Y probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Rc3h1 A G 1: 160,954,976 Y675C probably damaging Het
Samd3 T A 10: 26,251,887 S288T probably benign Het
Scaf4 G T 16: 90,250,289 P400Q unknown Het
Selplg T C 5: 113,820,179 D22G possibly damaging Het
Slc30a6 T C 17: 74,402,004 probably benign Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tnks G A 8: 34,965,661 A2V unknown Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Zbed5 A G 5: 129,903,198 T663A possibly damaging Het
Zbtb11 G A 16: 55,974,084 R8Q probably benign Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATCTCCCTGATTCAAAAGCAAATGC -3'
(R):5'- TAGACCTTGATTTTCTGATGCTGCC -3'

Sequencing Primer
(F):5'- GCAAATGCAAAGTTTATCAAAGTTTC -3'
(R):5'- AATGGTCCTCTTCCGATC -3'
Posted On2014-12-29