Incidental Mutation 'R2925:Olfr460'
ID255703
Institutional Source Beutler Lab
Gene Symbol Olfr460
Ensembl Gene ENSMUSG00000045514
Gene Nameolfactory receptor 460
SynonymsGA_x6K02T2P3E9-6947292-6946348, MOR120-2
MMRRC Submission 040510-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2925 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40569487-40574343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40571408 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 7 (S7R)
Ref Sequence ENSEMBL: ENSMUSP00000151187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051540] [ENSMUST00000101491] [ENSMUST00000216942]
Predicted Effect probably benign
Transcript: ENSMUST00000051540
AA Change: S7R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054887
Gene: ENSMUSG00000045514
AA Change: S7R

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 3e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 296 3e-5 PFAM
Pfam:7tm_1 40 290 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101491
SMART Domains Protein: ENSMUSP00000099030
Gene: ENSMUSG00000029915

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
CLECT 48 161 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216942
AA Change: S7R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1157 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,298 T93A probably damaging Het
4932438A13Rik G T 3: 37,007,122 A3327S probably damaging Het
9530003J23Rik C T 10: 117,234,431 R147Q probably benign Het
AI314180 T A 4: 58,833,928 K851* probably null Het
Akr1c21 A G 13: 4,576,350 probably null Het
Alk A G 17: 72,603,207 V168A probably benign Het
Ap4b1 A G 3: 103,820,681 E337G probably damaging Het
Btn2a2 A G 13: 23,481,814 S283P probably damaging Het
Ctcfl C T 2: 173,094,696 E628K probably damaging Het
Cul9 G A 17: 46,510,981 T1856M probably benign Het
Defb41 T C 1: 18,260,633 D30G probably damaging Het
Dnaic1 A T 4: 41,597,919 I74F probably damaging Het
Fbln2 T A 6: 91,265,855 C846S probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gm498 A T 7: 143,883,999 R147* probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nek4 G A 14: 30,951,710 G29S probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr1029 T A 2: 85,975,781 C179* probably null Het
Olfr1079 C T 2: 86,538,547 D121N probably damaging Het
Olfr206 A T 16: 59,345,343 Y119* probably null Het
P2ry13 G A 3: 59,209,380 H326Y probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Rc3h1 A G 1: 160,954,976 Y675C probably damaging Het
Samd3 T A 10: 26,251,887 S288T probably benign Het
Scaf4 G T 16: 90,250,289 P400Q unknown Het
Selplg T C 5: 113,820,179 D22G possibly damaging Het
Slc30a6 T C 17: 74,402,004 probably benign Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tnks G A 8: 34,965,661 A2V unknown Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Zbed5 A G 5: 129,903,198 T663A possibly damaging Het
Zbtb11 G A 16: 55,974,084 R8Q probably benign Het
Other mutations in Olfr460
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Olfr460 APN 6 40571454 missense probably benign 0.01
IGL01599:Olfr460 APN 6 40572252 missense probably damaging 0.99
IGL02168:Olfr460 APN 6 40571383 utr 5 prime probably benign
PIT4280001:Olfr460 UTSW 6 40571716 missense probably damaging 0.98
R0964:Olfr460 UTSW 6 40572205 missense probably benign 0.06
R1446:Olfr460 UTSW 6 40571899 missense probably benign 0.06
R4295:Olfr460 UTSW 6 40572156 missense probably damaging 1.00
R4382:Olfr460 UTSW 6 40572064 missense probably damaging 1.00
R7432:Olfr460 UTSW 6 40572306 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTTGGATAGAAATAACAGCCATGC -3'
(R):5'- ATCACGGGCACAATAACAGTTG -3'

Sequencing Primer
(F):5'- CTGTGGAGGTAAGGACTGC -3'
(R):5'- CAGTTGTAACCAGGATTTCCAGGATG -3'
Posted On2014-12-29